G138859



Basic Information


Item Value
gene id G138859
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 3191620 ~ 3191938 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU157782
AGTTGGTCCACTTCTTGCTTGAGTGTTGTATACTCTGCTGATTGCTGGTCAGCCAGTGAGTCATTATAAACACGGTTAGTGATTCTGAGATCCATGAAAACTGATGTTAAAGCATGTGGAGTCAAGGCATCTGTGCTTTCAGTTGGGGAATCCAACGCAGAGTTATTGACAGAGTTTACACCTGAATCAGATTTTGATATATTCATCACAAGGAGTTTTTTTTGTGCGTGTCTTTATCTTTTTTTGCATAATATTTATAATTGATTATTACACAAAAAATGAAAAATTTGTCATCAGTTATTCACCCACGTGTCACGAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU157782 True 319 lncRNA 0.37 1 3191620 3191938
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000027_03174793_03181990 NA coding upstream 9312 3174793 ~ 3182308 (+)
CI01000027_03159177_03163102 NA coding upstream 28295 3158969 ~ 3163325 (+)
CI01000027_03142352_03156415 NA coding upstream 34543 3142110 ~ 3157077 (+)
CI01000027_03110196_03113083 NA coding upstream 78211 3109207 ~ 3113409 (+)
CI01000027_03014464_03027710 E430025E21RIK, STRUMPELLIN, KIAA0196 coding upstream 163758 3013856 ~ 3027862 (+)
CI01000027_03202787_03208051 MTX1A coding downstream 10849 3202787 ~ 3208301 (+)
CI01000027_03212432_03231800 THBS3, THBS3A coding downstream 20494 3212432 ~ 3231862 (+)
CI01000027_03233523_03240000 HFE2 coding downstream 41585 3233523 ~ 3240002 (+)
CI01000027_03243374_03247133 TXNIP, TXNIPB coding downstream 51216 3243154 ~ 3247170 (+)
CI01000027_03278134_03279807 ANKRD34A coding downstream 86196 3278134 ~ 3281022 (+)
G138836 NA non-coding upstream 54753 3129459 ~ 3136867 (+)
G138835 NA non-coding upstream 63678 3127355 ~ 3127942 (+)
G138834 NA non-coding upstream 64345 3127043 ~ 3127275 (+)
G138833 NA non-coding upstream 65945 3125449 ~ 3125675 (+)
G138832 NA non-coding upstream 66591 3124797 ~ 3125029 (+)
G138888 NA non-coding downstream 56540 3248478 ~ 3248706 (+)
G138892 NA non-coding downstream 62992 3254930 ~ 3255207 (+)
G138884 NA non-coding downstream 117892 3309830 ~ 3314832 (+)
G138904 NA non-coding downstream 127345 3319283 ~ 3320531 (+)
G138925 NA non-coding downstream 225746 3417684 ~ 3417948 (+)
G138515 NA other upstream 1514760 1664408 ~ 1676860 (+)
G138436 NA other upstream 1683804 1506961 ~ 1507816 (+)
G138290 NA other upstream 2192439 995970 ~ 999181 (+)
G138247 NA other upstream 2322045 855388 ~ 893121 (+)
G138238 NA other upstream 2359937 829774 ~ 831683 (+)
G138915 NA other downstream 292449 3484387 ~ 3486647 (+)
G138953 NA other downstream 310134 3502072 ~ 3520065 (+)
G140436 NA other downstream 1545460 4737398 ~ 4774262 (+)
G140440 NA other downstream 1588479 4780417 ~ 4785660 (+)
CI01000027_05050310_05055447 NA other downstream 1856985 5050310 ~ 5055755 (+)

Expression


G138859 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.4.
End of interactive chart.

G138859 Expression in each Bioproject

Bar chart with 10 bars.
G138859 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network