G140025


Basic Information

Item Value
gene id G140025
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 3253109 ~ 3253580 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU159128
CCGGGATAGTTATTCCAGCTGTCCTTCAACTCGGGTAATTAGGATGCAGCACTCCGCCTGGATGGCCGTGTACTGAAAACAAAAGCAACGTAAGCACCCTACACAATGTCCAACCTGTCCTGCCCTTCATAGATGGGTGAAAAATTGAGTTTTATACAAAGAACACTCAGTCCACACACACTTATTCCAGGAACATGATCCTTTTTGACACTTGAGGTCTGAGATTGTAGGACACTCTGCATGGTAAAAGCTTTATCTGTGTTCACATCATTCCTAACCCCATTTGAATAAGGCTGAGAGCATGAGGATCAGTTCAGAGCTAAAATATAATGCTAACATGATTCAGGCAATTCATTATTCATTAAAAAAGTCATCAAATATATGTTAGCTAAAATACTTTCTGGAGAAGATTGTCAAACTAATGCAGTGACCAGCAAACAGAAGAGTGAATCAGCATTCAGCACGATATCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU159128 True 472 lncRNA 0.40 1 3253109 3253580

Neighbor

gene id symbol gene type direction distance location
CI01000027_03186359_03192441 NA coding downstream 60668 3186099 ~ 3192441 (-)
CI01000027_03117518_03132307 RUNDC3B coding downstream 120802 3115633 ~ 3132307 (-)
CI01000027_03101390_03106479 NA coding downstream 146630 3101089 ~ 3106479 (-)
CI01000027_03035114_03099542 ADAM22 coding downstream 153567 3035114 ~ 3099542 (-)
CI01000027_02989304_02990854 NA coding downstream 262255 2989289 ~ 2990854 (-)
CI01000027_03261114_03264008 POLR3GLB, POLR3GL coding upstream 7534 3261114 ~ 3264008 (-)
CI01000027_03297095_03298505 NA coding upstream 43452 3297032 ~ 3299512 (-)
CI01000027_03301041_03302954 NA coding upstream 47320 3300900 ~ 3303506 (-)
CI01000027_03371533_03388330 DPY19L1L coding upstream 117669 3371249 ~ 3389135 (-)
CI01000027_03468269_03469904 NA coding upstream 214284 3467864 ~ 3470215 (-)
G140011 NA non-coding downstream 21697 3229313 ~ 3231412 (-)
G139998 NA non-coding downstream 56406 3196470 ~ 3196703 (-)
G139980 NA non-coding downstream 92702 3160050 ~ 3160407 (-)
G139967 NA non-coding downstream 93735 3158395 ~ 3159374 (-)
G139972 NA non-coding downstream 115096 3137807 ~ 3138013 (-)
G140026 NA non-coding upstream 1347 3254927 ~ 3255168 (-)
G139971 NA non-coding upstream 2544 3256124 ~ 3256513 (-)
G140038 NA non-coding upstream 52125 3305705 ~ 3336881 (-)
G140035 NA non-coding upstream 97860 3351440 ~ 3352713 (-)
G140078 NA non-coding upstream 139274 3392854 ~ 3393199 (-)
CI01000027_02226447_02227499 NA other downstream 1025084 2225781 ~ 2227499 (-)
CI01000027_02119227_02124423 NA other downstream 1127081 2119131 ~ 2125142 (-)
CI01000027_01303308_01319462 NR2F5, NR2F1, NR2F1.L, NR2F2 other downstream 1932948 1302034 ~ 1321178 (-)
CI01000027_01241417_01245177 NA other downstream 2006132 1240478 ~ 1246267 (-)
G139117 NA other downstream 3015530 234212 ~ 237579 (-)
G140118 NA other upstream 247954 3509352 ~ 3584679 (-)
CI01000027_03787377_03788902 NA other upstream 533798 3787377 ~ 3790279 (-)
CI01000027_03922380_03931033 NA other upstream 668816 3922242 ~ 3931033 (-)
G141481 NA other upstream 1118667 4372247 ~ 4412810 (-)
G141488 NA other upstream 1253895 4507475 ~ 4508971 (-)

Expression


Co-expression Network