G138959


Basic Information

Item Value
gene id G138959
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 3447979 ~ 3503193 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU157892
AGTCTAGTAAGTCTAACCTCCACCATGGGTCATCTTGCACTTCAGTAGCAGTACAGGATCCATGTTCATAATGTGAGTCACGATTTCCATCAATAGCATTACTGGCATGACCATTTGCTGACCAAGGATTTCCAACCAGGTCCGACTGTGTGGCCTTGCCATATAAAGCGAGATTTTTGGCTAAATTGATAAAGCATAGTCAAAATGTGTAATAAAAACAAGGAAATGAATAAATCAAAATAATAATAATAATAATAATAAAACATTTGACCATATAATATTTCACTTTTGATTTCAATGATTATTTCTCAGGATTTATTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU157892 True 321 lncRNA 0.33 2 3447979 3503193

Neighbor

gene id symbol gene type direction distance location
CI01000027_03421902_03436988 NA coding upstream 10763 3421828 ~ 3437216 (+)
CI01000027_03335011_03357910 SLC4A7 coding upstream 89702 3335011 ~ 3358277 (+)
CI01000027_03278134_03279807 ANKRD34A coding upstream 166957 3278134 ~ 3281022 (+)
CI01000027_03243374_03247133 TXNIP, TXNIPB coding upstream 200809 3243154 ~ 3247170 (+)
CI01000027_03233523_03240000 HFE2 coding upstream 207977 3233523 ~ 3240002 (+)
CI01000027_03524553_03546701 SMARCC1, SMARCC1A coding downstream 20414 3523607 ~ 3546701 (+)
CI01000027_03570192_03600805 CSPG5A coding downstream 66999 3570192 ~ 3600805 (+)
CI01000027_03610825_03621755 PPOX coding downstream 107550 3610743 ~ 3621892 (+)
CI01000027_03660816_03671233 KCNJ9, KCNJ6, KCNJ5 coding downstream 157623 3660816 ~ 3671515 (+)
CI01000027_03675758_03678539 FBL coding downstream 172565 3675758 ~ 3678649 (+)
G138934 NA non-coding upstream 13922 3433847 ~ 3434057 (+)
G138926 NA non-coding upstream 29289 3418423 ~ 3418690 (+)
G138925 NA non-coding upstream 30031 3417684 ~ 3417948 (+)
G138904 NA non-coding upstream 127448 3319283 ~ 3320531 (+)
G138884 NA non-coding upstream 133147 3309830 ~ 3314832 (+)
G138954 NA non-coding downstream 4329 3507522 ~ 3514673 (+)
G138985 NA non-coding downstream 122120 3625313 ~ 3625608 (+)
G139002 NA non-coding downstream 240816 3744009 ~ 3744238 (+)
G138958 NA non-coding downstream 284162 3787355 ~ 3787850 (+)
G138515 NA other upstream 1771119 1664408 ~ 1676860 (+)
G138436 NA other upstream 1940163 1506961 ~ 1507816 (+)
G138290 NA other upstream 2448798 995970 ~ 999181 (+)
G138247 NA other upstream 2578404 855388 ~ 893121 (+)
G138238 NA other upstream 2616296 829774 ~ 831683 (+)
G140436 NA other downstream 1234205 4737398 ~ 4774262 (+)
G140440 NA other downstream 1277224 4780417 ~ 4785660 (+)
CI01000027_05050310_05055447 NA other downstream 1545730 5050310 ~ 5055755 (+)
CI01000027_05069310_05070638 NA other downstream 1566159 5067917 ~ 5070868 (+)
CI01000027_05071693_05072917 NA other downstream 1568869 5071693 ~ 5073136 (+)

Expression


Co-expression Network