G140267


Basic Information

Item Value
gene id G140267
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 3849360 ~ 3849642 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU159431
TATAAGCTTAAAGAGACAGGGTCTGGGGTTTAAAACTGGTACAAGCAGTGGAGTCTGGCTTCTTGCCTGCAAAGGCAAATCTTCTGACCAGAGGATGGATTCTTTTTGGTGGCTGAGCCCTCTTCATCTTGACATCCTCATCGTGAAATGGATTCTGAAAAGACGTGAGATTCCTTGCCACAACAACACTGCCTCTTTTCTGTGGGTCAGCAACAGGCTTCACAGGAACACAGGTTATTTCCAGAACAGACATGTTCGTGGACACAGCAACAGGACGTTCACA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU159431 True 283 lncRNA 0.47 1 3849360 3849642

Neighbor

gene id symbol gene type direction distance location
CI01000027_03832200_03836030 NA coding downstream 12830 3831205 ~ 3836530 (-)
CI01000027_03787377_03788902 NA coding downstream 59081 3787377 ~ 3790279 (-)
CI01000027_03750919_03761043 FLI1, FLI1B coding downstream 88297 3750830 ~ 3761063 (-)
CI01000027_03694455_03710634 NA coding downstream 138321 3694227 ~ 3711039 (-)
CI01000027_03689861_03690969 NA coding downstream 158149 3689439 ~ 3691211 (-)
CI01000027_03898513_03905519 NA coding upstream 47624 3897266 ~ 3906494 (-)
CI01000027_03922380_03931033 NA coding upstream 72600 3922242 ~ 3931033 (-)
CI01000027_03969492_03973741 NA coding upstream 119056 3968698 ~ 3974176 (-)
CI01000027_04008272_04011121 NA coding upstream 158538 4008180 ~ 4012622 (-)
CI01000027_04039778_04040714 NA coding upstream 189467 4039109 ~ 4040714 (-)
G140237 NA non-coding downstream 24922 3823904 ~ 3824438 (-)
G140262 NA non-coding downstream 43931 3802715 ~ 3805429 (-)
G140221 NA non-coding downstream 74280 3774856 ~ 3775080 (-)
G140220 NA non-coding downstream 74810 3773514 ~ 3774550 (-)
G140167 NA non-coding downstream 99321 3746879 ~ 3750039 (-)
G140268 NA non-coding upstream 19825 3869467 ~ 3869871 (-)
G140308 NA non-coding upstream 149046 3998688 ~ 4036880 (-)
G140363 NA non-coding upstream 257261 4106903 ~ 4107518 (-)
G140370 NA non-coding upstream 262954 4112596 ~ 4112829 (-)
G141402 NA non-coding upstream 270678 4120320 ~ 4120527 (-)
G140118 NA other downstream 264681 3509352 ~ 3584679 (-)
CI01000027_02226447_02227499 NA other downstream 1621335 2225781 ~ 2227499 (-)
CI01000027_02119227_02124423 NA other downstream 1723332 2119131 ~ 2125142 (-)
CI01000027_01303308_01319462 NR2F5, NR2F1, NR2F1.L, NR2F2 other downstream 2529199 1302034 ~ 1321178 (-)
G141481 NA other upstream 522605 4372247 ~ 4412810 (-)
G141488 NA other upstream 657833 4507475 ~ 4508971 (-)
G141728 NA other upstream 1027425 4877067 ~ 4877766 (-)
G141588 NA other upstream 1258693 5108335 ~ 5201155 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_012118 CR388164.1 coding NC_007128.7 CM002901.2 24837682 ~ 24838927 (-)