G141429


Basic Information

Item Value
gene id G141429
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 4168392 ~ 4168706 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU160705
AGCAGATCCGTTTCCTCGCTAAAGAAGCGTTCAGTTTTTCCACTTGCAAATTCCGTCATGTAAGTAGTGAATCCACCATGGCACGAGCGCAGCTGGTTTTTAAAGGGAATGGGAGATGAGACTCTGATTGGTTTATTTCACGTTATGCCCAAAACACACCCATTACTCATTAAGAGAATAGGGACAGCCCTTTTAGACCATGCACCGGGCGCGCCGACCATTTTTCCCGTTCTTAAACTAGAAAAAGTGGATTCGGACACGCCCTAAGTGCACTTGCGCCGTGCGCTTTAAACCATGTGCTTAGATCGTTAAAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU160705 True 315 lncRNA 0.46 1 4168392 4168706

Neighbor

gene id symbol gene type direction distance location
CI01000027_04039778_04040714 NA coding downstream 127678 4039109 ~ 4040714 (-)
CI01000027_04008272_04011121 NA coding downstream 155770 4008180 ~ 4012622 (-)
CI01000027_03969492_03973741 NA coding downstream 194216 3968698 ~ 3974176 (-)
CI01000027_03922380_03931033 NA coding downstream 237359 3922242 ~ 3931033 (-)
CI01000027_03898513_03905519 NA coding downstream 261898 3897266 ~ 3906494 (-)
CI01000027_04206424_04209369 NA coding upstream 36904 4205610 ~ 4209445 (-)
CI01000027_04233680_04249553 SCAP coding upstream 64936 4233642 ~ 4249553 (-)
CI01000027_04254645_04264857 NA coding upstream 85461 4254167 ~ 4264857 (-)
CI01000027_04324807_04339354 NA coding upstream 155970 4324676 ~ 4339354 (-)
CI01000027_04401843_04403095 S100A11, S100T, S100S coding upstream 232784 4401490 ~ 4403095 (-)
G141421 NA non-coding downstream 9790 4158354 ~ 4158602 (-)
G141405 NA non-coding downstream 44972 4122321 ~ 4123420 (-)
G141402 NA non-coding downstream 47865 4120320 ~ 4120527 (-)
G140370 NA non-coding downstream 55563 4112596 ~ 4112829 (-)
G140363 NA non-coding downstream 60874 4106903 ~ 4107518 (-)
G141461 NA non-coding upstream 95196 4263902 ~ 4264722 (-)
G141470 NA non-coding upstream 112799 4281505 ~ 4281829 (-)
G141471 NA non-coding upstream 113203 4281909 ~ 4282135 (-)
G141475 NA non-coding upstream 121568 4290274 ~ 4290481 (-)
CI01000027_03787377_03788902 NA other downstream 379170 3787377 ~ 3790279 (-)
G140118 NA other downstream 583713 3509352 ~ 3584679 (-)
CI01000027_02226447_02227499 NA other downstream 1940367 2225781 ~ 2227499 (-)
CI01000027_02119227_02124423 NA other downstream 2042364 2119131 ~ 2125142 (-)
G141481 NA other upstream 203541 4372247 ~ 4412810 (-)
G141488 NA other upstream 338769 4507475 ~ 4508971 (-)
G141728 NA other upstream 708361 4877067 ~ 4877766 (-)
G141588 NA other upstream 939629 5108335 ~ 5201155 (-)
CI01000027_05447458_05450346 PON2, PON3.2, PON3.1 other upstream 1280620 5447424 ~ 5450461 (-)

Expression


Co-expression Network