G140522


Basic Information

Item Value
gene id G140522
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 4671107 ~ 4671477 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU159725
TAAAATCCTCTCTCTCAGATTTTTTGAGGACCTCTGGCACCCTCTTGTTGGGTCCCTGGGGGCCCTCGGATTCCACTTTGAAAACATCTGCTCTAAATCATTGTTTTTCAACCTGAGTGCTGTCTGATGCAAAAGGGGTCTGTAAAATGATTTTAAATAGAATGTCTGCTTAATATGTCATATGTATATTCTGACGTGTAACCTGTTCCCATAAAAATGAAGAACTGACAATATAACAAAAGATTAGACAAGTCACTTCAGAACGCGTGATTTGTTTTCCAATTTCAGCTAGCAAACGATAAAAATCAGCCAATCAGAATCCACCCGAGTTTAAACGTAGGCATTTAAAAGGGTGCACAAGATGCAGGTAC

Function

NR:

description
PREDICTED: cilia- and flagella-associated protein 61-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU159725 True 371 lncRNA 0.39 1 4671107 4671477

Neighbor

gene id symbol gene type direction distance location
CI01000027_04655825_04667764 NA coding upstream 3240 4654783 ~ 4667867 (+)
CI01000027_04551022_04551875 NA coding upstream 119114 4550712 ~ 4551993 (+)
CI01000027_04537765_04549872 NA coding upstream 121178 4537342 ~ 4549929 (+)
CI01000027_04497623_04499224 NA coding upstream 171759 4497623 ~ 4499348 (+)
CI01000027_04488278_04495470 FLAD1 coding upstream 175030 4488278 ~ 4496077 (+)
CI01000027_04713891_04717190 NA coding downstream 42303 4713780 ~ 4717359 (+)
CI01000027_04725469_04727486 EFNA1B coding downstream 52416 4723893 ~ 4728283 (+)
CI01000027_04768212_04770488 KRTCAP2 coding downstream 96735 4768212 ~ 4770687 (+)
CI01000027_04774573_04774740 NA coding downstream 103096 4774573 ~ 4775489 (+)
CI01000027_04777135_04777760 NA coding downstream 105010 4776487 ~ 4779338 (+)
G140512 NA non-coding upstream 157522 4513410 ~ 4513585 (+)
G140509 NA non-coding upstream 165955 4504854 ~ 4505152 (+)
G140465 NA non-coding upstream 240414 4428037 ~ 4430693 (+)
G140495 NA non-coding upstream 256531 4414354 ~ 4414576 (+)
G140447 NA non-coding upstream 258038 4404326 ~ 4413069 (+)
G140587 NA non-coding downstream 20657 4692134 ~ 4692704 (+)
G140596 NA non-coding downstream 36748 4708225 ~ 4708506 (+)
G140597 NA non-coding downstream 37311 4708788 ~ 4708995 (+)
G140455 NA non-coding downstream 62231 4733708 ~ 4736668 (+)
G140435 NA non-coding downstream 65417 4736894 ~ 4822645 (+)
G138953 NA other upstream 1151042 3502072 ~ 3520065 (+)
G138915 NA other upstream 1184460 3484387 ~ 3486647 (+)
G138515 NA other upstream 2994247 1664408 ~ 1676860 (+)
G138436 NA other upstream 3163291 1506961 ~ 1507816 (+)
G138290 NA other upstream 3671926 995970 ~ 999181 (+)
G140436 NA other downstream 65921 4737398 ~ 4774262 (+)
G140440 NA other downstream 108940 4780417 ~ 4785660 (+)
CI01000027_05050310_05055447 NA other downstream 377446 5050310 ~ 5055755 (+)
CI01000027_05069310_05070638 NA other downstream 397875 5067917 ~ 5070868 (+)
CI01000027_05071693_05072917 NA other downstream 400585 5071693 ~ 5073136 (+)

Expression


Co-expression Network