G140633


Basic Information

Item Value
gene id G140633
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 4833012 ~ 4833260 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU159840
ATGATGGATGGTTATGTTCCTTTATGAGATTTCAGTGACAGCCTGTTTTGTTCCATTACGACATTTCAAAGATGGTCGATTTCGTTCCATTATGAGATCGCAATGATTGTCGGTTTTGTTCCTTTGTTCCTTTACAAGATTTCAAAGATGGTTGGTTTTGTTTCATTGCGAAATTTCAATGATGGTTGGTTTTGTTCCTTTACTAGATCTCAATGACAGTCAGTTTTGTTCCTTTACAAGATCTCAATG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU159840 True 249 lncRNA 0.36 1 4833012 4833260

Neighbor

gene id symbol gene type direction distance location
CI01000027_04777135_04777760 NA coding upstream 53699 4776487 ~ 4779338 (+)
CI01000027_04774573_04774740 NA coding upstream 58034 4774573 ~ 4775489 (+)
CI01000027_04768212_04770488 KRTCAP2 coding upstream 62325 4768212 ~ 4770687 (+)
CI01000027_04725469_04727486 EFNA1B coding upstream 104729 4723893 ~ 4728283 (+)
CI01000027_04713891_04717190 NA coding upstream 115653 4713780 ~ 4717359 (+)
CI01000027_04835989_04851147 SNX27.L, SNX27B, SNX27, SNX27A coding downstream 2729 4835989 ~ 4851178 (+)
CI01000027_04860802_04872130 NA coding downstream 27542 4860802 ~ 4872566 (+)
CI01000027_04887494_04956477 KCNN3 coding downstream 54056 4887316 ~ 4957488 (+)
CI01000027_04978217_04987503 NA coding downstream 144957 4978217 ~ 4987503 (+)
CI01000027_05018992_05033275 NA coding downstream 185000 5018260 ~ 5034290 (+)
G140475 NA non-coding upstream 7024 4824940 ~ 4825988 (+)
G140435 NA non-coding upstream 10367 4736894 ~ 4822645 (+)
G140436 NA non-coding upstream 53674 4737398 ~ 4774262 (+)
G140455 NA non-coding upstream 96344 4733708 ~ 4736668 (+)
G140597 NA non-coding upstream 124017 4708788 ~ 4708995 (+)
G140454 NA non-coding downstream 39855 4873115 ~ 4874023 (+)
G140640 NA non-coding downstream 48820 4882080 ~ 4882366 (+)
G140641 NA non-coding downstream 49319 4882579 ~ 4882895 (+)
G140642 NA non-coding downstream 50149 4883409 ~ 4883610 (+)
G140643 NA non-coding downstream 50425 4883685 ~ 4883910 (+)
G140440 NA other upstream 47352 4780417 ~ 4785660 (+)
G138953 NA other upstream 1312947 3502072 ~ 3520065 (+)
G138915 NA other upstream 1346365 3484387 ~ 3486647 (+)
G138515 NA other upstream 3156152 1664408 ~ 1676860 (+)
CI01000027_05050310_05055447 NA other downstream 215663 5050310 ~ 5055755 (+)
CI01000027_05069310_05070638 NA other downstream 236092 5067917 ~ 5070868 (+)
CI01000027_05071693_05072917 NA other downstream 238802 5071693 ~ 5073136 (+)
G140862 NA other downstream 879352 5712612 ~ 5712702 (+)
CI01000027_05757143_05758496 NA other downstream 923722 5756982 ~ 5758881 (+)

Expression


Co-expression Network