G140645


Basic Information

Item Value
gene id G140645
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 4885619 ~ 4885818 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU159852
CTATTTTACTGATTATTTCGTCAGAGCAGCGCTGACAACATTTCTGTGCGAGTGTGTGTCTGTACTATAGCTACAGTTTGTGTGCGTTTGAAAGAGAGAGAGAGAGAGCGACACAATAAAACGTATTTTCTGGCAAACACCATGACAATAATTTGTCGTTTACATCCTATTGTTTACTATATTTATTTGCTTGGTCAGTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU159852 True 200 lncRNA 0.38 1 4885619 4885818

Neighbor

gene id symbol gene type direction distance location
CI01000027_04860802_04872130 NA coding upstream 13053 4860802 ~ 4872566 (+)
CI01000027_04835989_04851147 SNX27.L, SNX27B, SNX27, SNX27A coding upstream 34441 4835989 ~ 4851178 (+)
CI01000027_04777135_04777760 NA coding upstream 106306 4776487 ~ 4779338 (+)
CI01000027_04774573_04774740 NA coding upstream 110641 4774573 ~ 4775489 (+)
CI01000027_04768212_04770488 KRTCAP2 coding upstream 114932 4768212 ~ 4770687 (+)
CI01000027_04887494_04956477 KCNN3 coding downstream 1498 4887316 ~ 4957488 (+)
CI01000027_04978217_04987503 NA coding downstream 92399 4978217 ~ 4987503 (+)
CI01000027_05018992_05033275 NA coding downstream 132442 5018260 ~ 5034290 (+)
CI01000027_05050310_05055447 NA coding downstream 164492 5050310 ~ 5055755 (+)
CI01000027_05061061_05063086 APOEB coding downstream 173921 5059739 ~ 5063414 (+)
G140643 NA non-coding upstream 1709 4883685 ~ 4883910 (+)
G140642 NA non-coding upstream 2009 4883409 ~ 4883610 (+)
G140641 NA non-coding upstream 2724 4882579 ~ 4882895 (+)
G140640 NA non-coding upstream 3253 4882080 ~ 4882366 (+)
G140454 NA non-coding upstream 11596 4873115 ~ 4874023 (+)
G140437 NA non-coding downstream 89909 4975727 ~ 4991547 (+)
G140672 NA non-coding downstream 152727 5038545 ~ 5038798 (+)
G140674 NA non-coding downstream 153423 5039241 ~ 5039487 (+)
G140683 NA non-coding downstream 216573 5102391 ~ 5108232 (+)
G140440 NA other upstream 99959 4780417 ~ 4785660 (+)
G140436 NA other upstream 106281 4737398 ~ 4774262 (+)
G138953 NA other upstream 1365554 3502072 ~ 3520065 (+)
G138915 NA other upstream 1398972 3484387 ~ 3486647 (+)
G138515 NA other upstream 3208759 1664408 ~ 1676860 (+)
CI01000027_05069310_05070638 NA other downstream 183534 5067917 ~ 5070868 (+)
CI01000027_05071693_05072917 NA other downstream 186244 5071693 ~ 5073136 (+)
G140862 NA other downstream 826794 5712612 ~ 5712702 (+)
CI01000027_05757143_05758496 NA other downstream 871164 5756982 ~ 5758881 (+)

Expression


Co-expression Network