G140674


Basic Information

Item Value
gene id G140674
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 5039241 ~ 5039487 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU159883
CCACAGTCAACGCAGCCATCTACCAGGAAATTTTAGAGCACTTCATGCTTCCTTCTGCTGACAAGCTTTATGGAGATGCTGATTTCATTTTCCAGCAGGATTTGGCACCTGCCCACACTGCCAAAGGTACCAAAAGCTGGTTCAATGACCATGGTGTTACTGTGCTTGATTGGCCAGCAAACTCGCCTGACCTGAATCCTATAGAGAATCTATGGGGTATTGTCAAGAGGAAGATGAGAGACACCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU159883 True 247 lncRNA 0.47 1 5039241 5039487

Neighbor

gene id symbol gene type direction distance location
CI01000027_05018992_05033275 NA coding upstream 4951 5018260 ~ 5034290 (+)
CI01000027_04978217_04987503 NA coding upstream 51738 4978217 ~ 4987503 (+)
CI01000027_04887494_04956477 KCNN3 coding upstream 81753 4887316 ~ 4957488 (+)
CI01000027_04860802_04872130 NA coding upstream 166675 4860802 ~ 4872566 (+)
CI01000027_04835989_04851147 SNX27.L, SNX27B, SNX27, SNX27A coding upstream 188063 4835989 ~ 4851178 (+)
CI01000027_05050310_05055447 NA coding downstream 10823 5050310 ~ 5055755 (+)
CI01000027_05061061_05063086 APOEB coding downstream 20252 5059739 ~ 5063414 (+)
CI01000027_05069310_05070638 NA coding downstream 28430 5067917 ~ 5070868 (+)
CI01000027_05071693_05072917 NA coding downstream 32206 5071693 ~ 5073136 (+)
CI01000027_05074328_05075547 NA coding downstream 34841 5074328 ~ 5075740 (+)
G140672 NA non-coding upstream 443 5038545 ~ 5038798 (+)
G140437 NA non-coding upstream 47694 4975727 ~ 4991547 (+)
G140645 NA non-coding upstream 153423 4885619 ~ 4885818 (+)
G140643 NA non-coding upstream 155331 4883685 ~ 4883910 (+)
G140683 NA non-coding downstream 62904 5102391 ~ 5108232 (+)
G140685 NA non-coding downstream 70332 5109819 ~ 5114502 (+)
G140684 NA non-coding downstream 78981 5118468 ~ 5164862 (+)
G140680 NA non-coding downstream 158139 5197626 ~ 5201086 (+)
G140734 NA non-coding downstream 163709 5203196 ~ 5203505 (+)
G140440 NA other upstream 253581 4780417 ~ 4785660 (+)
G140436 NA other upstream 259903 4737398 ~ 4774262 (+)
G138953 NA other upstream 1519176 3502072 ~ 3520065 (+)
G138915 NA other upstream 1552594 3484387 ~ 3486647 (+)
G138515 NA other upstream 3362381 1664408 ~ 1676860 (+)
G140862 NA other downstream 673125 5712612 ~ 5712702 (+)
CI01000027_05757143_05758496 NA other downstream 717495 5756982 ~ 5758881 (+)

Expression


Co-expression Network