G141080


Basic Information

Item Value
gene id G141080
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 6408938 ~ 6409292 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU160324
GGGGAGTGTTATTGCTGGCGATGCCATCGGATTTTATCTAAAATATCTTAATTTGTGTTCCGAAGATGAACGAAGGTCTTACGGGTGTGGAATGACATGAGGGTGAGTAATTAATGACAGAACTTTCATTTTTGGGTGAAATAACTCTTTAAGTGTCCTAAAAGTAATGCCACAATACAAAAATAATAATACTTTATACTATTGTCTTTATGCAAAATATCATTCCTGTTTTCCTTTCGATTTTGGTGGTAAAATGTGACCTGGACACTACTTTGTGAGATCTACTAGTACATCAACGAATCCACTACTAGAATAATTAAATTCACCTCTGTTAATAAATAAATAAAATGTGTAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU160324 True 355 lncRNA 0.33 1 6408938 6409292

Neighbor

gene id symbol gene type direction distance location
CI01000027_06392269_06407773 PTPN3 coding upstream 1098 6391758 ~ 6407840 (+)
CI01000027_06335278_06348176 NA coding upstream 60085 6335160 ~ 6348853 (+)
CI01000027_06329025_06333271 NA coding upstream 75602 6328719 ~ 6333336 (+)
CI01000027_06327905_06328111 NA coding upstream 80718 6327905 ~ 6328220 (+)
CI01000027_06108585_06112721 NA coding upstream 296183 6108585 ~ 6112755 (+)
CI01000027_06410011_06426230 EPB41L4B coding downstream 719 6410011 ~ 6426936 (+)
CI01000027_06458587_06470747 KIAA1429 coding downstream 49295 6458587 ~ 6470747 (+)
CI01000027_06470650_06470837 NA coding downstream 61358 6470650 ~ 6470988 (+)
CI01000027_06477695_06489968 RAD54B coding downstream 68403 6477695 ~ 6490033 (+)
CI01000027_06495825_06497691 GEM coding downstream 86059 6495351 ~ 6498078 (+)
G141093 NA non-coding upstream 134 6408549 ~ 6408804 (+)
G141117 NA non-coding upstream 54152 6351099 ~ 6354786 (+)
G141038 NA non-coding upstream 83594 6322828 ~ 6325344 (+)
G141032 NA non-coding upstream 106154 6301000 ~ 6302784 (+)
G141044 NA non-coding upstream 108355 6300314 ~ 6300583 (+)
G141114 NA non-coding downstream 28633 6437925 ~ 6440544 (+)
G141113 NA non-coding downstream 35002 6444294 ~ 6445548 (+)
G141108 NA non-coding downstream 37290 6446582 ~ 6446858 (+)
G141112 NA non-coding downstream 41845 6451137 ~ 6451529 (+)
G141097 NA non-coding downstream 43827 6453119 ~ 6456366 (+)
G141052 NA other upstream 137338 6271367 ~ 6271600 (+)
G140924 NA other upstream 443612 5963206 ~ 5965326 (+)
CI01000027_05757143_05758496 NA other upstream 650068 5756982 ~ 5758881 (+)
G140862 NA other upstream 688173 5712612 ~ 5712702 (+)
CI01000027_05071693_05072917 NA other upstream 1335802 5071693 ~ 5073136 (+)
CI01000027_06706050_06708485 NA other downstream 297085 6705983 ~ 6708513 (+)
G141082 NA other downstream 489119 6898411 ~ 6900923 (+)
CI01000027_06951132_06956691 GLIPR2, GLIPR2L other downstream 543654 6951132 ~ 6957767 (+)
CI01000027_07469157_07471720 NA other downstream 1059452 7468964 ~ 7471999 (+)
CI01000027_07947743_07951397 NA other downstream 1541411 7947657 ~ 7951942 (+)

Expression


Co-expression Network