G141145


Basic Information

Item Value
gene id G141145
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 6530592 ~ 6530818 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU160395
CATATGTAGTGGGGGGAAAAAATGAGAAGAAATGTAGGCTATTTCGTGTTAAACAAGTTGTTTTTTTAAATGAGGAGTTAGCTAATCTAACATCTCATTGCAGCTTGTTGGTTAGGCGGTGATGCGCTATGAAATTATTGCGGGGCAAATGAAAATATTACTTTAATTCTGAAAGTAGCCTAATCATCATCATCATCATCATCATCATTCAGATCATCGCAGAGGGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU160395 True 227 lncRNA 0.37 1 6530592 6530818

Neighbor

gene id symbol gene type direction distance location
CI01000027_06504915_06514535 NA coding upstream 15442 6504311 ~ 6515150 (+)
CI01000027_06495825_06497691 GEM coding upstream 32514 6495351 ~ 6498078 (+)
CI01000027_06477695_06489968 RAD54B coding upstream 40559 6477695 ~ 6490033 (+)
CI01000027_06470650_06470837 NA coding upstream 59604 6470650 ~ 6470988 (+)
CI01000027_06458587_06470747 KIAA1429 coding upstream 59845 6458587 ~ 6470747 (+)
CI01000027_06604099_06652019 GALNT1 coding downstream 73281 6604099 ~ 6652188 (+)
CI01000027_06706050_06708485 NA coding downstream 175165 6705983 ~ 6708513 (+)
CI01000027_06785671_06803146 NR4A3 coding downstream 254853 6785671 ~ 6803213 (+)
CI01000027_06811768_06817052 NA coding downstream 280276 6811094 ~ 6817163 (+)
CI01000027_06859191_06877582 NA coding downstream 328373 6859191 ~ 6877625 (+)
G141138 NA non-coding upstream 37192 6493154 ~ 6493400 (+)
G141097 NA non-coding upstream 74226 6453119 ~ 6456366 (+)
G141112 NA non-coding upstream 79063 6451137 ~ 6451529 (+)
G141108 NA non-coding upstream 83734 6446582 ~ 6446858 (+)
G141113 NA non-coding upstream 85044 6444294 ~ 6445548 (+)
G141146 NA non-coding downstream 3266 6534084 ~ 6534323 (+)
G141147 NA non-coding downstream 5559 6536377 ~ 6536592 (+)
G141106 NA non-coding downstream 133197 6664015 ~ 6666990 (+)
G141111 NA non-coding downstream 149014 6679832 ~ 6680388 (+)
G141052 NA other upstream 258992 6271367 ~ 6271600 (+)
G140924 NA other upstream 565266 5963206 ~ 5965326 (+)
CI01000027_05757143_05758496 NA other upstream 771722 5756982 ~ 5758881 (+)
G140862 NA other upstream 809827 5712612 ~ 5712702 (+)
CI01000027_05071693_05072917 NA other upstream 1457456 5071693 ~ 5073136 (+)
G141082 NA other downstream 367593 6898411 ~ 6900923 (+)
CI01000027_06951132_06956691 GLIPR2, GLIPR2L other downstream 422128 6951132 ~ 6957767 (+)
CI01000027_07469157_07471720 NA other downstream 937926 7468964 ~ 7471999 (+)
CI01000027_07947743_07951397 NA other downstream 1419885 7947657 ~ 7951942 (+)

Expression


Co-expression Network