G141255


Basic Information

Item Value
gene id G141255
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 7195275 ~ 7195494 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU160509
TTTTTTTCAATAGAAGTGAGAACAAAAAGTATTGTGCATCAAAACTATACAAACTTTTAATAATATGAATCATTTGACACAAATAACTTGGAACATTTTCAAGATGATGTGTTTTTATCATTTTGTCAAGTCTTTTTCACTTTCATTAAATGGGAAAAATTTACCCTTTTGTGTTACATGGGGGAAAATCATACACATCTGGTACAACATGAGGATGTAA

Function

NR:

description
PREDICTED: EMILIN-2-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU160509 True 220 lncRNA 0.28 1 7195275 7195494

Neighbor

gene id symbol gene type direction distance location
CI01000027_07142789_07157141 NA coding upstream 37288 7142315 ~ 7157987 (+)
CI01000027_07055665_07057014 NA coding upstream 138021 7055117 ~ 7057254 (+)
CI01000027_06951132_06956691 GLIPR2, GLIPR2L coding upstream 238433 6951132 ~ 6957767 (+)
CI01000027_06947553_06950983 NA coding upstream 244292 6946261 ~ 6950983 (+)
CI01000027_06915303_06927001 TMEM67 coding upstream 267967 6915303 ~ 6927308 (+)
CI01000027_07216718_07225808 NA coding downstream 20274 7215768 ~ 7226571 (+)
CI01000027_07292677_07331000 FAM188A coding downstream 97183 7292677 ~ 7331032 (+)
CI01000027_07375781_07378401 ITGA8 coding downstream 180287 7375781 ~ 7378421 (+)
CI01000027_07432479_07451012 FAM171A1 coding downstream 236985 7432479 ~ 7452012 (+)
CI01000027_07455850_07459062 NMT2, NMT1 coding downstream 260356 7455850 ~ 7459062 (+)
G141254 NA non-coding upstream 1648 7193425 ~ 7193627 (+)
G141110 NA non-coding upstream 4108 7187529 ~ 7191167 (+)
G141096 NA non-coding upstream 214804 6978723 ~ 6980471 (+)
G141221 NA non-coding upstream 221791 6973260 ~ 6973484 (+)
G141220 NA non-coding upstream 222944 6972116 ~ 6972331 (+)
G141321 NA non-coding downstream 110190 7305684 ~ 7329095 (+)
G141354 NA non-coding downstream 137928 7333422 ~ 7333632 (+)
G141355 NA non-coding downstream 138415 7333909 ~ 7334137 (+)
G141364 NA non-coding downstream 305663 7501157 ~ 7501487 (+)
G141330 NA non-coding downstream 306572 7502066 ~ 7514879 (+)
G141082 NA other upstream 294352 6898411 ~ 6900923 (+)
CI01000027_06706050_06708485 NA other upstream 484643 6705983 ~ 6708513 (+)
G141052 NA other upstream 923675 6271367 ~ 6271600 (+)
G140924 NA other upstream 1229949 5963206 ~ 5965326 (+)
CI01000027_07469157_07471720 NA other downstream 273250 7468964 ~ 7471999 (+)
CI01000027_07947743_07951397 NA other downstream 755209 7947657 ~ 7951942 (+)
CI01000027_08026500_08029412 ENSAB, ENSA other downstream 830903 8025788 ~ 8032041 (+)
CI01000027_08255251_08264629 NA other downstream 1062843 8255073 ~ 8264897 (+)
G143033 NA other downstream 2533321 9728815 ~ 9729551 (+)

Expression


Co-expression Network