G141364


Basic Information

Item Value
gene id G141364
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 7501157 ~ 7501487 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU160637
AGATAAGAAGCAGATAGGTGGAGCGTGGGTGGAGTTCGCTCCCCAGAGCATTTGGCACTGCTCGTCCAGACTGGCACACACACCGCTGTAGCAGTAGGAGGAACCGTCCTTGCATGACTCTCCATTCTGCAGAAACACATTAGGAGGACAGTAGGGGGAAGTGCCGGTGCAGTACTCTGGCAAATCGCACTCTCCCAACGGCTCCCGACACACCGACCCGGCCACACGCAACTAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU160637 True 235 lncRNA 0.57 2 7501157 7501487

Neighbor

gene id symbol gene type direction distance location
CI01000027_07469157_07471720 NA coding upstream 29158 7468964 ~ 7471999 (+)
CI01000027_07455850_07459062 NMT2, NMT1 coding upstream 42095 7455850 ~ 7459062 (+)
CI01000027_07432479_07451012 FAM171A1 coding upstream 49145 7432479 ~ 7452012 (+)
CI01000027_07375781_07378401 ITGA8 coding upstream 122736 7375781 ~ 7378421 (+)
CI01000027_07292677_07331000 FAM188A coding upstream 170125 7292677 ~ 7331032 (+)
CI01000027_07529488_07537870 DCST2 coding downstream 28001 7529488 ~ 7539111 (+)
CI01000027_07541256_07541975 NA coding downstream 39769 7541256 ~ 7542152 (+)
CI01000027_07545610_07559939 NA coding downstream 44123 7545610 ~ 7560158 (+)
CI01000027_07561011_07562818 NA coding downstream 59404 7560891 ~ 7563845 (+)
CI01000027_07605090_07608785 NA coding downstream 103373 7604860 ~ 7609540 (+)
G141355 NA non-coding upstream 167020 7333909 ~ 7334137 (+)
G141354 NA non-coding upstream 167525 7333422 ~ 7333632 (+)
G141321 NA non-coding upstream 172062 7305684 ~ 7329095 (+)
G141255 NA non-coding upstream 305663 7195275 ~ 7195494 (+)
G141254 NA non-coding upstream 307530 7193425 ~ 7193627 (+)
G141330 NA non-coding downstream 579 7502066 ~ 7514879 (+)
G141378 NA non-coding downstream 28312 7529799 ~ 7530002 (+)
G141380 NA non-coding downstream 34630 7536117 ~ 7536333 (+)
G142360 NA non-coding downstream 215633 7717120 ~ 7722230 (+)
CI01000027_07789066_07797594 NA non-coding downstream 283287 7784774 ~ 7800723 (+)
CI01000027_06951132_06956691 GLIPR2, GLIPR2L other upstream 543390 6951132 ~ 6957767 (+)
G141082 NA other upstream 600234 6898411 ~ 6900923 (+)
CI01000027_06706050_06708485 NA other upstream 790525 6705983 ~ 6708513 (+)
G141052 NA other upstream 1229557 6271367 ~ 6271600 (+)
CI01000027_07947743_07951397 NA other downstream 449216 7947657 ~ 7951942 (+)
CI01000027_08026500_08029412 ENSAB, ENSA other downstream 524910 8025788 ~ 8032041 (+)
CI01000027_08255251_08264629 NA other downstream 756850 8255073 ~ 8264897 (+)
G143033 NA other downstream 2227328 9728815 ~ 9729551 (+)

Expression


Co-expression Network