G143372


Basic Information

Item Value
gene id G143372
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 7946278 ~ 7946521 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU162899
GCACATTTTCTCATCTTAGTCCATAACCTTCAGTAAGTTCATCTTCAGTCATCTCAGATTTTCAGTAGATAAGGTTGTTTTTTAGCTGGTAGACTGATTTGATGGTATGAATAAATAGCACCTCTTTCTGAGCATCATTCTCATGAGGCCCTGTTAGCTTGTCATGAACACTTCCCCTTGTTAGTCAACAACCTGTGTTCCCTGTACAATGTGTCAGTGTATGAGGTCTACATGAAAATTGTCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU162899 True 244 lncRNA 0.39 1 7946278 7946521

Neighbor

gene id symbol gene type direction distance location
CI01000027_07924688_07926502 LINGO4B coding downstream 19776 7924130 ~ 7926502 (-)
CI01000027_07904624_07919811 NA coding downstream 26467 7904624 ~ 7919811 (-)
CI01000027_07888504_07893711 TLR18 coding downstream 52567 7888504 ~ 7893711 (-)
CI01000027_07876459_07878548 NA coding downstream 67730 7875493 ~ 7878548 (-)
CI01000027_07850115_07861432 BCAN coding downstream 84846 7849703 ~ 7861432 (-)
CI01000027_07993673_08002214 ONECUTL coding upstream 46814 7993335 ~ 8006263 (-)
CI01000027_08016916_08025375 NA coding upstream 70008 8016529 ~ 8025455 (-)
CI01000027_08073979_08077754 SCNM1 coding upstream 127140 8073661 ~ 8077754 (-)
CI01000027_08081583_08083496 TNFAIP8L2B, TNFAIP8L2 coding upstream 134748 8081269 ~ 8083496 (-)
CI01000027_08091338_08097220 NA coding upstream 144772 8091293 ~ 8097220 (-)
G143371 NA non-coding downstream 1199 7944848 ~ 7945079 (-)
G143341 NA non-coding downstream 141512 7804315 ~ 7804766 (-)
G143334 NA non-coding downstream 147634 7793708 ~ 7798644 (-)
G143304 NA non-coding downstream 170650 7775403 ~ 7775628 (-)
G142307 NA non-coding downstream 403323 7539471 ~ 7542955 (-)
G143316 NA non-coding upstream 4183 7950704 ~ 7985293 (-)
G143320 NA non-coding upstream 9547 7956068 ~ 7964780 (-)
G143383 NA non-coding upstream 73630 8020151 ~ 8021259 (-)
G143385 NA non-coding upstream 76233 8022754 ~ 8022982 (-)
G143325 NA other downstream 60229 7884535 ~ 7886049 (-)
G143267 NA other downstream 272509 7669329 ~ 7673769 (-)
G142299 NA other downstream 506087 7439178 ~ 7440191 (-)
G142209 NA other downstream 788280 7153623 ~ 7157998 (-)
G142203 NA other downstream 803215 7141094 ~ 7143063 (-)
G144365 NA other upstream 2592259 10538780 ~ 10542148 (-)

Expression


Co-expression Network