G143395



Basic Information


Item Value
gene id G143395
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 8093317 ~ 8093593 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU162922
GTCTTTGGTGTCACATGATCCTTCAGAAATCATTATAATATGCTGATTTGGTGCTCAGATAACATTACTTATTATTATGAACAGTTGTGCTGCTTAATATTTTTTGTGGAAACGTGATACTTTCTTTCCAAGATTCTATGATTAAAAGAACGTTCAAAAGAACAGAATTTTTAAATACAATTTTTACTGTCACTTTTGATCAGTTCAATGCATCCTTTCTGAATAAAAGTATTGAATTCAAACAAAAATCTTACTGACCCTAAATTTTCAATGGTAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU162922 True 277 lncRNA 0.29 1 8093317 8093593

Neighbor


gene id symbol gene type direction distance location
CI01000027_08081583_08083496 TNFAIP8L2B, TNFAIP8L2 coding downstream 9821 8081269 ~ 8083496 (-)
CI01000027_08073979_08077754 SCNM1 coding downstream 15563 8073661 ~ 8077754 (-)
CI01000027_08016916_08025375 NA coding downstream 67862 8016529 ~ 8025455 (-)
CI01000027_07993673_08002214 ONECUTL coding downstream 89652 7993335 ~ 8006263 (-)
CI01000027_07924688_07926502 LINGO4B coding downstream 166815 7924130 ~ 7926502 (-)
CI01000027_08134523_08134951 NA coding upstream 40894 8134487 ~ 8135309 (-)
CI01000027_08285855_08291534 NA coding upstream 192176 8285769 ~ 8292823 (-)
CI01000027_08422679_08426771 CCT3, TCPG, CCT3.L coding upstream 329086 8422679 ~ 8426771 (-)
CI01000027_08429132_08434558 NA coding upstream 334719 8428312 ~ 8436258 (-)
CI01000027_08443968_08446252 NA coding upstream 349584 8443177 ~ 8446436 (-)
G143393 NA non-coding downstream 2586 8090002 ~ 8090731 (-)
G143389 NA non-coding downstream 40459 8052511 ~ 8052858 (-)
G143314 NA non-coding downstream 59336 8032981 ~ 8033981 (-)
G143385 NA non-coding downstream 70335 8022754 ~ 8022982 (-)
G143383 NA non-coding downstream 72058 8020151 ~ 8021259 (-)
G143403 NA non-coding upstream 22246 8115839 ~ 8117546 (-)
G143422 NA non-coding upstream 76993 8170586 ~ 8170812 (-)
G143502 NA non-coding upstream 134558 8228151 ~ 8228372 (-)
G143504 NA non-coding upstream 139592 8233185 ~ 8233388 (-)
G143476 NA non-coding upstream 183675 8277268 ~ 8319468 (-)
G143325 NA other downstream 207268 7884535 ~ 7886049 (-)
G143267 NA other downstream 419548 7669329 ~ 7673769 (-)
G142299 NA other downstream 653126 7439178 ~ 7440191 (-)
G142209 NA other downstream 935319 7153623 ~ 7157998 (-)
G142203 NA other downstream 950254 7141094 ~ 7143063 (-)
G144365 NA other upstream 2445187 10538780 ~ 10542148 (-)

Expression



Co-expression Network