G143602



Basic Information


Item Value
gene id G143602
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 8660958 ~ 8661221 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU163137
TCGATGAGCGTTGACTCAGTGATGGCTTCCATGTTTTGCCTGCATGGGTGAATATTTGTATGTTACCATGACTCTGTCTAGAAGTGCAAAAAGAAAATTTGGTAAAGAAGATCTAGTTTCTCCTACCTGAAATGCAGCTCAACCAGAGCTTTGGAATTGTCAGGTGTATATTATTAAGCCAGGAGATGAGTGGAATGTGGATTTATTCGGCTCAGCCAGGCCTCAGGGTCTGTCTCCTCTGGGCTATTCATTAAGGGAATTATC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU163137 True 264 lncRNA 0.43 1 8660958 8661221

Neighbor


gene id symbol gene type direction distance location
CI01000027_08595524_08646502 NA coding downstream 14456 8594938 ~ 8646502 (-)
CI01000027_08568349_08570750 NA coding downstream 90208 8567985 ~ 8570750 (-)
CI01000027_08537911_08550747 LDLRAD4B coding downstream 109500 8536827 ~ 8551458 (-)
CI01000027_08514843_08515829 MC5RB, MC5R, MC5RA coding downstream 142617 8514488 ~ 8518341 (-)
CI01000027_08483034_08503082 LMNA coding downstream 157876 8482939 ~ 8503082 (-)
CI01000027_08671118_08685781 NA coding upstream 9874 8671095 ~ 8685781 (-)
CI01000027_08688706_08696073 SLC45A4 coding upstream 27470 8688691 ~ 8697369 (-)
CI01000027_08701843_08702938 NA coding upstream 39561 8700782 ~ 8702938 (-)
CI01000027_08713799_08734144 DGAT1B coding upstream 52333 8713554 ~ 8734144 (-)
CI01000027_08820113_08821952 SCRT1A, SCRT2, SCRT1, SCRT1B coding upstream 158798 8820019 ~ 8822352 (-)
G143601 NA non-coding downstream 445 8660060 ~ 8660513 (-)
G143598 NA non-coding downstream 3278 8657309 ~ 8657680 (-)
G143597 NA non-coding downstream 5470 8655180 ~ 8655488 (-)
G143479 NA non-coding downstream 70638 8578428 ~ 8590320 (-)
G143463 NA non-coding downstream 127780 8528645 ~ 8533178 (-)
G143603 NA non-coding upstream 366 8661587 ~ 8661806 (-)
G143608 NA non-coding upstream 22884 8684105 ~ 8684426 (-)
G143615 NA non-coding upstream 47906 8709127 ~ 8709529 (-)
G143467 NA non-coding upstream 50582 8711803 ~ 8713014 (-)
G143622 NA non-coding upstream 77393 8738614 ~ 8738830 (-)
G143325 NA other downstream 774909 7884535 ~ 7886049 (-)
G143267 NA other downstream 987189 7669329 ~ 7673769 (-)
G142299 NA other downstream 1220767 7439178 ~ 7440191 (-)
G142209 NA other downstream 1502960 7153623 ~ 7157998 (-)
G142203 NA other downstream 1517895 7141094 ~ 7143063 (-)
G144365 NA other upstream 1877559 10538780 ~ 10542148 (-)

Expression



Co-expression Network