G143831


Basic Information

Item Value
gene id G143831
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 9531816 ~ 9532071 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU163403
AGAGGATGTTAGCAAGATGGGGTGAAGATTTGCTTCACAGAGGGGTGGCAGCTTTAAGGCGGTACAGCCTATATATGCTATGGACGCTTTCTGCCAAATCCCTCTATTACGACAAGAAATGATCTTTCTTCCTGTGGCACAGCTGGTCAATCCCAAATGAATGTGAGAAGATATTCATGGCATATGTAATGCAGCATATGTCAAAGAAAGCCACAATTTTTCCTTTTTACATGGATCTCAAGTAAGACTCTAAGGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU163403 True 256 lncRNA 0.42 1 9531816 9532071

Neighbor

gene id symbol gene type direction distance location
CI01000027_09504696_09522574 MMS22L coding downstream 8979 9504602 ~ 9522837 (-)
CI01000027_09476738_09478257 FAM26F coding downstream 53399 9476499 ~ 9478417 (-)
CI01000027_09472471_09475553 NA coding downstream 55664 9472352 ~ 9476152 (-)
CI01000027_09464510_09467490 RWDD1 coding downstream 64076 9464211 ~ 9467740 (-)
CI01000027_09437673_09445306 IMA5, KPNA5 coding downstream 86268 9436243 ~ 9445548 (-)
CI01000027_09668229_09671091 NA coding upstream 135019 9667090 ~ 9671091 (-)
CI01000027_09702760_09713076 FAXCB coding upstream 170150 9702221 ~ 9713362 (-)
CI01000027_09714931_09721135 COQ3 coding upstream 182805 9714876 ~ 9721135 (-)
CI01000027_09722965_09729563 NA coding upstream 190633 9722704 ~ 9730482 (-)
CI01000027_09735579_09766657 USP45 coding upstream 203418 9735489 ~ 9766657 (-)
G143830 NA non-coding downstream 958 9530146 ~ 9530858 (-)
G143820 NA non-coding downstream 53030 9478566 ~ 9478786 (-)
G143818 NA non-coding downstream 74277 9457226 ~ 9457539 (-)
G143817 NA non-coding downstream 76923 9454235 ~ 9454893 (-)
G143694 NA non-coding downstream 107192 9423411 ~ 9424624 (-)
G143833 NA non-coding upstream 4295 9536366 ~ 9536634 (-)
G143839 NA non-coding upstream 14148 9546219 ~ 9546419 (-)
G143852 NA non-coding upstream 17870 9549941 ~ 9550328 (-)
G143853 NA non-coding upstream 23628 9555699 ~ 9556051 (-)
G143855 NA non-coding upstream 31587 9563658 ~ 9563922 (-)
G143325 NA other downstream 1645767 7884535 ~ 7886049 (-)
G143267 NA other downstream 1858047 7669329 ~ 7673769 (-)
G142299 NA other downstream 2091625 7439178 ~ 7440191 (-)
G142209 NA other downstream 2373818 7153623 ~ 7157998 (-)
G142203 NA other downstream 2388753 7141094 ~ 7143063 (-)
G144365 NA other upstream 1006709 10538780 ~ 10542148 (-)

Expression


Co-expression Network