G143075


Basic Information

Item Value
gene id G143075
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 9558122 ~ 9558380 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU162557
CTGAAGATATTCTGTGCAGTCTGTATAAGGGTAGGGAAGCATGATGTATTGGCACCGGTAACACTTTATTTCCACTTTAGACATTCTATAAACTATATGTTACTTTGCAACTACATGTCAACTACCAGACATTAGAGTATTAGTAGTCTGTCTGCTTAATATCTGCTGACACATATATTTTGATGGTCCTCCAACAGACATTCTACTGTCTAGGCTATAAGTACCTTTTCAAGTACATGTCAACTTATTCTACTAACCC

Function

NR:

description
PREDICTED: ELAV-like protein 4 isoform X1

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU162557 True 259 lncRNA 0.37 1 9558122 9558380

Neighbor

gene id symbol gene type direction distance location
CI01000027_09484034_09501412 KLHL32 coding upstream 55867 9484034 ~ 9502255 (+)
CI01000027_09459448_09462994 NA coding upstream 95022 9459448 ~ 9463100 (+)
CI01000027_09448387_09455263 NA coding upstream 102829 9447047 ~ 9455293 (+)
CI01000027_09424746_09432978 NA coding upstream 124651 9424746 ~ 9433471 (+)
CI01000027_09414743_09422093 SPHK2 coding upstream 135643 9412872 ~ 9422479 (+)
CI01000027_09562530_09572606 NA coding downstream 4116 9562496 ~ 9572635 (+)
CI01000027_09661837_09663114 POU3F2B, POU3F2 coding downstream 103143 9661523 ~ 9663857 (+)
CI01000027_09767653_09768743 NA coding downstream 209273 9767653 ~ 9769402 (+)
CI01000027_09774092_09779035 NA coding downstream 215612 9773992 ~ 9779129 (+)
CI01000027_09783491_09789725 PRDM13 coding downstream 225111 9783491 ~ 9790186 (+)
G143066 NA non-coding upstream 79936 9476391 ~ 9478186 (+)
G143061 NA non-coding upstream 82512 9475009 ~ 9475610 (+)
G143064 NA non-coding upstream 83432 9474181 ~ 9474690 (+)
G143062 NA non-coding upstream 85183 9471169 ~ 9472939 (+)
G143060 NA non-coding upstream 90080 9467823 ~ 9468042 (+)
G143093 NA non-coding downstream 34365 9592745 ~ 9593407 (+)
G143110 NA non-coding downstream 124146 9682526 ~ 9682767 (+)
G143034 NA non-coding downstream 142624 9701004 ~ 9710260 (+)
G143156 NA non-coding downstream 306251 9864631 ~ 9865105 (+)
G143159 NA non-coding downstream 338313 9896693 ~ 9898052 (+)
CI01000027_08255251_08264629 NA other upstream 1297296 8255073 ~ 8264897 (+)
CI01000027_08026500_08029412 ENSAB, ENSA other upstream 1526081 8025788 ~ 8032041 (+)
CI01000027_07947743_07951397 NA other upstream 1606180 7947657 ~ 7951942 (+)
CI01000027_07469157_07471720 NA other upstream 2086408 7468964 ~ 7471999 (+)
CI01000027_06951132_06956691 GLIPR2, GLIPR2L other upstream 2600355 6951132 ~ 6957767 (+)
G143033 NA other downstream 170435 9728815 ~ 9729551 (+)

Expression


Co-expression Network