G143865


Basic Information

Item Value
gene id G143865
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 9640889 ~ 9641154 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU163468
TGAAATCAGGCCTCTCGTGAGCTCTTATCGGCTGGAAATGAATTGGCTCATTTGCGGCATAGCGTGAAAGGAGAATGTTGTGGCTTTGAGTAGGAGCTTCCAGAACGGATTCCAGATCTGTGTCAACTTCCATAAGCAGAACTGTTACAGTGACCTACACTTTTCACCGATCAGAGATCGGCCTGGAGAAGCTTGTTAGCAACCAATCTGTGGTATCTGTCAGGAGTTATTAAGCAGAGAAACACACGAGACAGGAGTAGCGAACT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU163468 True 266 lncRNA 0.47 1 9640889 9641154

Neighbor

gene id symbol gene type direction distance location
CI01000027_09504696_09522574 MMS22L coding downstream 118052 9504602 ~ 9522837 (-)
CI01000027_09476738_09478257 FAM26F coding downstream 162472 9476499 ~ 9478417 (-)
CI01000027_09472471_09475553 NA coding downstream 164737 9472352 ~ 9476152 (-)
CI01000027_09464510_09467490 RWDD1 coding downstream 173149 9464211 ~ 9467740 (-)
CI01000027_09437673_09445306 IMA5, KPNA5 coding downstream 195341 9436243 ~ 9445548 (-)
CI01000027_09668229_09671091 NA coding upstream 25936 9667090 ~ 9671091 (-)
CI01000027_09702760_09713076 FAXCB coding upstream 61067 9702221 ~ 9713362 (-)
CI01000027_09714931_09721135 COQ3 coding upstream 73722 9714876 ~ 9721135 (-)
CI01000027_09722965_09729563 NA coding upstream 81550 9722704 ~ 9730482 (-)
CI01000027_09735579_09766657 USP45 coding upstream 94335 9735489 ~ 9766657 (-)
G143863 NA non-coding downstream 1207 9639475 ~ 9639682 (-)
G143860 NA non-coding downstream 13444 9627225 ~ 9627445 (-)
G143855 NA non-coding downstream 76967 9563658 ~ 9563922 (-)
G143853 NA non-coding downstream 84838 9555699 ~ 9556051 (-)
G143852 NA non-coding downstream 90561 9549941 ~ 9550328 (-)
G143866 NA non-coding upstream 2533 9643687 ~ 9643918 (-)
G143868 NA non-coding upstream 4185 9645339 ~ 9645575 (-)
G143883 NA non-coding upstream 105746 9746900 ~ 9823496 (-)
G143897 NA non-coding upstream 208218 9849372 ~ 9864061 (-)
G143930 NA non-coding upstream 234477 9875631 ~ 9964010 (-)
G143325 NA other downstream 1754840 7884535 ~ 7886049 (-)
G143267 NA other downstream 1967120 7669329 ~ 7673769 (-)
G142299 NA other downstream 2200698 7439178 ~ 7440191 (-)
G142209 NA other downstream 2482891 7153623 ~ 7157998 (-)
G142203 NA other downstream 2497826 7141094 ~ 7143063 (-)
G144365 NA other upstream 897626 10538780 ~ 10542148 (-)

Expression


Co-expression Network