G144388


Basic Information

Item Value
gene id G144388
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 10594790 ~ 10594997 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU164024
GTTTTTTTAGCTTACATCTCAAAGGAATTGCCTAAGGTATTTTTCTAATTGCACACAGGTAAATCCAGTCACTACCCAATTTGCCGGCTGGAACTCTGCAACTACACAAACTTAGTGCCGGTCACATTGGAAGTTACCTAGCTGGGGACTATTTTCAGGCGCTGCATAATATCATTGCGCCTGCTGCACCCATGGTACGGCAGCAAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU164024 True 208 lncRNA 0.45 1 10594790 10594997

Neighbor

gene id symbol gene type direction distance location
CI01000027_10542331_10544115 DNALI1 coding downstream 50675 10542331 ~ 10544115 (-)
CI01000027_10472075_10477507 RSPO1 coding downstream 117283 10471972 ~ 10477507 (-)
CI01000027_10401933_10404459 UTP11, UTP11L coding downstream 189078 10401703 ~ 10405712 (-)
CI01000027_10204234_10204662 NA coding downstream 390057 10204105 ~ 10204733 (-)
CI01000027_10042471_10043723 PNRC2 coding downstream 550090 10042376 ~ 10044700 (-)
G144387 NA non-coding downstream 1473 10593066 ~ 10593317 (-)
G144372 NA non-coding downstream 49698 10544829 ~ 10545092 (-)
G144358 NA non-coding downstream 89473 10505018 ~ 10505317 (-)
G144244 NA non-coding downstream 142231 10452294 ~ 10452559 (-)
G144215 NA non-coding downstream 147224 10443237 ~ 10447566 (-)
G144425 NA non-coding upstream 45748 10640745 ~ 10640992 (-)
G144432 NA non-coding upstream 64691 10659688 ~ 10659921 (-)
G144433 NA non-coding upstream 65430 10660427 ~ 10660701 (-)
G144365 NA other downstream 52642 10538780 ~ 10542148 (-)
G143325 NA other downstream 2708741 7884535 ~ 7886049 (-)
G143267 NA other downstream 2921021 7669329 ~ 7673769 (-)
G142299 NA other downstream 3154599 7439178 ~ 7440191 (-)
G142209 NA other downstream 3436792 7153623 ~ 7157998 (-)

Expression


Co-expression Network