G152522


Basic Information

Item Value
gene id G152522
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 3052495 ~ 3052730 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU173240
CTGTAGCTGGATGGATTAATCCACATAGCTCTCTCCATTTACTCCCTAAATCTGAGCCGCTGAAGACGAGGTGGATTAATTTTGTTTTCGAAGAAAATGCTCCCTCAACTCTACCGAAATTCGTTTATGTCTGCGCGAATCATTTCACAATACAAAGGGACAATACAAAACAGAGGTTGTGCTAAAAAGTTGTTACTCAAGGATAGATCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU173240 True 210 lncRNA 0.40 2 3052495 3052730

Neighbor

gene id symbol gene type direction distance location
CI01000029_02976262_03013586 MAN1A1 coding upstream 38582 2976107 ~ 3013913 (+)
CI01000029_02956475_02956765 NA coding upstream 95607 2955888 ~ 2970825 (+)
CI01000029_02904113_02950205 NA coding upstream 101172 2903780 ~ 2951323 (+)
CI01000029_02860076_02868432 NA coding upstream 183558 2858909 ~ 2868937 (+)
CI01000029_02772065_02813214 TBC1D32 coding upstream 238004 2772065 ~ 2814491 (+)
CI01000029_03166200_03260925 FAM184A coding downstream 113470 3166200 ~ 3260925 (+)
CI01000029_03266557_03286137 NA coding downstream 213753 3266483 ~ 3286145 (+)
CI01000029_03291762_03308373 NA coding downstream 239032 3291762 ~ 3308793 (+)
CI01000029_03324084_03378615 CEP85L coding downstream 271354 3324084 ~ 3378615 (+)
CI01000029_03499444_03499713 NA coding downstream 446463 3499193 ~ 3500186 (+)
G152465 NA non-coding upstream 60342 2901660 ~ 2992153 (+)
G152446 NA non-coding upstream 316444 2735816 ~ 2736051 (+)
G152433 NA non-coding upstream 427748 2624445 ~ 2624747 (+)
G152432 NA non-coding upstream 428586 2623482 ~ 2623909 (+)
G153405 NA non-coding downstream 90257 3142987 ~ 3184240 (+)
G153423 NA non-coding downstream 138863 3191593 ~ 3201635 (+)
G153430 NA non-coding downstream 344115 3396845 ~ 3490373 (+)
G153449 NA non-coding downstream 401580 3454310 ~ 3456618 (+)
G153461 NA non-coding downstream 431214 3483944 ~ 3484379 (+)
G152451 NA other upstream 289556 2761594 ~ 2762939 (+)
CI01000029_01526863_01527414 NA other upstream 1524596 1526754 ~ 1527899 (+)
G151495 NA other upstream 2680573 366541 ~ 371922 (+)
G151415 NA other upstream 2827250 170521 ~ 225245 (+)
G153475 NA other downstream 492395 3545125 ~ 3562004 (+)
G153790 NA other downstream 1680859 4733589 ~ 4740107 (+)
G154587 NA other downstream 2218290 5271020 ~ 5271535 (+)
CI01000029_05461497_05468985 BATF other downstream 2404511 5461497 ~ 5470346 (+)
G155079 NA other downstream 3229955 6282685 ~ 6288398 (+)

Expression


Co-expression Network