G153491


Basic Information

Item Value
gene id G153491
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 3698482 ~ 3731627 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU174311
TTGCCATCGCTTTAATGTAGGAAAACATATATTTTTAAATCAGATCTGATTACATTTTTAGTGCTTTGAAGAGTTCTATAATAAAACATGTTTAATGGGGACTGCCTCAAACTGGAACACATCCGGCGTGTGCATATAACCGTACAGACTGACAGTGGGCTTGACCGTTTGTAAAACTGAACTTCTGAACAGGGTCTTTAAAACAGCTTATGCATCAATAAAATTTCATTACTTTGAGTTGTTCACTTAAATTCCATTGCACATCATTGGACTTATCTGACTAATTCTCAGATTGGTTTAATATGGCTTTCTATCCAGTCGACAAACTTGGAGACGCGGGTATACACTCCAGGTTTCATGGCATTAGCACAGCCGAGACCCCATGATGTCACTCCCTGAAGGACGAAGGTGTTCTGTGCGTAGCAGACAAGAGGCCCACCACTGTCACCCTGAATGAGTGTGAGGAACACATCACAATTTAAGTTGTTATTCATTTAAAATCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU174311 True 503 lncRNA 0.40 2 3698482 3731627

Neighbor

gene id symbol gene type direction distance location
CI01000029_03689026_03697933 SLC22A2 coding upstream 408 3689026 ~ 3698074 (+)
CI01000029_03649051_03684709 IGF2R coding upstream 13602 3649051 ~ 3684880 (+)
CI01000029_03640782_03646346 NA coding upstream 52118 3640782 ~ 3646364 (+)
CI01000029_03511828_03527110 GOPC coding upstream 169744 3511828 ~ 3528842 (+)
CI01000029_03499444_03499713 NA coding upstream 198296 3499193 ~ 3500186 (+)
CI01000029_03830894_03838298 NA coding downstream 97980 3829607 ~ 3838325 (+)
CI01000029_03855238_03922931 MLLT4, AFDN coding downstream 123611 3855238 ~ 3923120 (+)
CI01000029_03976118_03980629 SNX9, SNX9B coding downstream 244491 3976118 ~ 3980800 (+)
CI01000029_04007545_04011744 NA coding downstream 275918 4007545 ~ 4012008 (+)
CI01000029_04060211_04069639 NA coding downstream 327111 4058738 ~ 4070460 (+)
G153513 NA non-coding upstream 95648 3602590 ~ 3602834 (+)
G153509 NA non-coding upstream 104159 3588702 ~ 3594323 (+)
G153505 NA non-coding upstream 126412 3571841 ~ 3572070 (+)
G153504 NA non-coding upstream 127050 3571151 ~ 3571432 (+)
G153492 NA non-coding downstream 18685 3750312 ~ 3984500 (+)
G153541 NA non-coding downstream 201478 3933105 ~ 3943762 (+)
G153555 NA non-coding downstream 260926 3992553 ~ 3994376 (+)
G153561 NA non-coding downstream 270697 4002324 ~ 4002561 (+)
G153562 NA non-coding downstream 271298 4002925 ~ 4003129 (+)
G153475 NA other upstream 136478 3545125 ~ 3562004 (+)
G152451 NA other upstream 935543 2761594 ~ 2762939 (+)
CI01000029_01526863_01527414 NA other upstream 2170583 1526754 ~ 1527899 (+)
G151495 NA other upstream 3326560 366541 ~ 371922 (+)
G151415 NA other upstream 3473237 170521 ~ 225245 (+)
G153790 NA other downstream 1001962 4733589 ~ 4740107 (+)
G154587 NA other downstream 1539393 5271020 ~ 5271535 (+)
CI01000029_05461497_05468985 BATF other downstream 1725614 5461497 ~ 5470346 (+)
G155079 NA other downstream 2551058 6282685 ~ 6288398 (+)
G155083 NA other downstream 2699908 6431535 ~ 6490294 (+)

Expression


Co-expression Network