G156852


Basic Information

Item Value
gene id G156852
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 8271449 ~ 8271686 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU178096
TTTTTGTTCTAATGAGATCATCAAAACGAGAAATGTCGATTCTTGCAGAACTTCAGTCATGTGACTGATGATTTTATTACATCATCAAGGTCAAGGCCCAGTATAGGCTCCACAAGACCAAAATAGCAGCAGCTCGTGGTCTTAAAGTTTATGGATATACAGTCAGGACTCGTCATTTTTAGACATTTTTATGAGTCTTTCTCTTTACCTGGAGCTGGTCAGAGGTCATGAGGCACTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU178096 True 238 lncRNA 0.40 1 8271449 8271686

Neighbor

gene id symbol gene type direction distance location
CI01000029_08250264_08262665 GATA4 coding downstream 8784 8250249 ~ 8262665 (-)
CI01000029_08237701_08245368 FDFT1 coding downstream 26081 8236195 ~ 8245368 (-)
CI01000029_08229070_08234969 CTSBB coding downstream 36480 8228965 ~ 8234969 (-)
CI01000029_08205518_08214627 NA coding downstream 56822 8205470 ~ 8214627 (-)
CI01000029_08185095_08190376 NA coding downstream 81073 8185029 ~ 8190376 (-)
CI01000029_08384203_08407906 NA coding upstream 111939 8382870 ~ 8407906 (-)
CI01000029_08463083_08479077 NA coding upstream 191306 8462992 ~ 8479190 (-)
CI01000029_08568672_08576837 SLC25A29 coding upstream 295345 8566372 ~ 8577143 (-)
CI01000029_08606896_08609369 NA coding upstream 333820 8605506 ~ 8610176 (-)
CI01000029_08690880_08711534 PPP2R5CB, PPP2R5C.L, PPP2R5C coding upstream 418639 8690325 ~ 8711919 (-)
G156851 NA non-coding downstream 428 8270752 ~ 8271021 (-)
G156850 NA non-coding downstream 3787 8267400 ~ 8267662 (-)
G156718 NA non-coding downstream 44881 8220390 ~ 8226568 (-)
CI01000029_08041274_08048935 NA non-coding downstream 224352 8040747 ~ 8049427 (-)
G156854 NA non-coding upstream 1585 8273271 ~ 8273498 (-)
G156895 NA non-coding upstream 87632 8359318 ~ 8359524 (-)
G156896 NA non-coding upstream 88264 8359950 ~ 8360239 (-)
G156897 NA non-coding upstream 89118 8360804 ~ 8361106 (-)
G156898 NA non-coding upstream 89469 8361155 ~ 8361398 (-)
G156495 NA other downstream 901902 7365007 ~ 7371921 (-)
G156542 NA other downstream 1100498 7170367 ~ 7170951 (-)
G154415 NA other downstream 3284024 4986108 ~ 4990990 (-)
CI01000029_04460778_04463540 FKBP1B other downstream 3794237 4460159 ~ 4463540 (-)
CI01000029_03698769_03707177 NA other downstream 4564197 3698572 ~ 3707883 (-)

Expression


Co-expression Network