G155848


Basic Information

Item Value
gene id G155848
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 8567615 ~ 8567913 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU176956
TTCATTATATGCCAACAGTGACAGCTCAAAAGCACTTCTTGTGTTTCTTTGCCTCAAGTTAACTCTAAAAGTGTTCAAGATATCTTAATATCCTTTTAGATTCTGGTTCTTAATAAACTTTTCTTTTGAAATCTTCATTTTCAAGGCCCTATATAGTTCAGTCCAAAAGATATGAGGATCTCAAAGCAGCTCCATGTTCAAATTGTTGATTTTTTTCCCATTTTCAGTGATCGAAAGGCCATTTTTGAGCTGTCACTGTTGGCATATAATGAAACAAAGATTGATAAAGTCAACAGATT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU176956 True 299 lncRNA 0.33 1 8567615 8567913

Neighbor

gene id symbol gene type direction distance location
CI01000029_08558693_08564749 MYH6, MYH7, MYH6.S coding upstream 2619 8558263 ~ 8564996 (+)
CI01000029_08533907_08555317 PAK6 coding upstream 11646 8533907 ~ 8555969 (+)
CI01000029_08506379_08516187 NA coding upstream 51310 8506379 ~ 8516305 (+)
CI01000029_08484998_08502958 NA coding upstream 64446 8484952 ~ 8503169 (+)
CI01000029_08443106_08447917 CDC40 coding upstream 119698 8442958 ~ 8447917 (+)
CI01000029_08578097_08583564 SLC25A47A coding downstream 9902 8577815 ~ 8583973 (+)
CI01000029_08654610_08655443 NA coding downstream 84669 8652582 ~ 8656550 (+)
CI01000029_08743604_08749941 WDR20 coding downstream 172821 8740734 ~ 8750337 (+)
CI01000029_08759743_08761002 GM2581, RPS29, RPS29.S, GM7618, GM7079 coding downstream 191830 8759696 ~ 8761326 (+)
CI01000029_08915550_08920146 NA coding downstream 346510 8914423 ~ 8920358 (+)
G155845 NA non-coding upstream 168 8566307 ~ 8567447 (+)
G155809 NA non-coding upstream 125264 8442140 ~ 8442351 (+)
G155769 NA non-coding upstream 183274 8382868 ~ 8384341 (+)
G155758 NA non-coding upstream 185831 8381585 ~ 8381784 (+)
G155757 NA non-coding upstream 189325 8378071 ~ 8378290 (+)
G155851 NA non-coding downstream 21473 8589386 ~ 8593261 (+)
G155855 NA non-coding downstream 25634 8593547 ~ 8593956 (+)
G155853 NA non-coding downstream 26649 8594562 ~ 8595141 (+)
G155860 NA non-coding downstream 28321 8596234 ~ 8597704 (+)
G155866 NA non-coding downstream 34899 8602812 ~ 8603042 (+)
G155627 NA other upstream 635438 7931480 ~ 7932177 (+)
G155522 NA other upstream 929781 7634833 ~ 7637834 (+)
CI01000029_06906861_06907157 NA other upstream 1660183 6905834 ~ 6908633 (+)
G155083 NA other upstream 2077321 6431535 ~ 6490294 (+)
G155079 NA other upstream 2279217 6282685 ~ 6288398 (+)
G156007 NA other downstream 396905 8964818 ~ 9064541 (+)

Expression


Co-expression Network