CI01000030_03018776_03042194 (FGF22)


Basic Information

Item Value
gene id CI01000030_03018776_03042194
gene name FGF22
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 3018776 ~ 3043773 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000030_03018776_03042194.mRNA
ATGTGCAAATGGACACCTACTACCGCTGGTCTCCACTTCGACCTCAGCTTCTCTGGCTCAGCCCTCCCTTCTTATCCTTATTCCCTGGTATGCCTGTCCTTACTCTTTCTGGTTTGCTCTGCTCTTGGAGGTTGCCCACCTGCACTGGGGCATGACCCCCTTCATGTGCTGGCACAGGGCACAAACTGCTCTTGGACTCTGGAGCGGCACACGCGCAGCTACAACCACCTAGAGGGTGACGTTCGCCTGCGACGCCTCTATTCCGCCAACAAGTTCTTTCTCTGCATAGACAAGACGGGCAAGGTGGATGGCACCCGTCGGAAGAATTACGCTGACAGTCTGATGGAAATCCGATCTGTCAGTGTGGGAGTTGTCGCCATCAAATCTGTCAGCACCGGCCTGTACTTAGCTATGTCCAAAAAGGGAACACTCTTCGGATCGGTCAGATACAACCCCAGCTGCAAGTTCAAAGAGCGCATCGAAGAGAACGGCTATAACACCTACGCCTCCCTGCGCTGGAAGCACAAGGGGAGGCAGATGTTCGTGTCGCTGAATGGCCGAGGGAAACCCCGCAGAGGCCACAAAGCTAGACGGAGACACCCATCTACTCATTTCCTCCCTATGCTGCCCACA

Function

symbol description
fgf22 Predicted to enable fibroblast growth factor receptor binding activity and growth factor activity. Acts upstream of or within cell proliferation in midbrain; midbrain-hindbrain boundary development; and roof plate formation. Predicted to be located in extracellular region. Predicted to be active in cytoplasm. Is expressed in midbrain; midbrain hindbrain boundary; midbrain hindbrain boundary neural rod; otic vesicle; and telencephalon. Orthologous to human FGF22 (fibroblast growth factor 22).

GO:

id name namespace
GO:0008083 growth factor activity molecular_function

KEGG:

id description
K04358 FGF; fibroblast growth factor

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000030_03018776_03042194.mRNA False 633 mRNA 0.55 3 3018776 3042194

Neighbor

gene id symbol gene type direction distance location
CI01000030_02919390_02954905 HCN2B, HCN2 coding upstream 63351 2919390 ~ 2955425 (+)
CI01000030_02911153_02916952 NA coding upstream 101824 2909400 ~ 2916952 (+)
CI01000030_02891265_02897170 FSTL3 coding upstream 120334 2891111 ~ 2898442 (+)
CI01000030_02843446_02856037 CBARPB coding upstream 162560 2843446 ~ 2856216 (+)
CI01000030_02705058_02731134 NA coding upstream 287625 2701811 ~ 2731151 (+)
CI01000030_03058744_03059657 NA coding downstream 13677 3055871 ~ 3059667 (+)
CI01000030_03060378_03062683 NA coding downstream 18133 3060327 ~ 3063096 (+)
CI01000030_03066708_03068158 NA coding downstream 24463 3066657 ~ 3068230 (+)
CI01000030_03070497_03070798 NA coding downstream 28261 3070455 ~ 3071137 (+)
CI01000030_03086334_03087738 NA coding downstream 44140 3086334 ~ 3087800 (+)
G158681 NA non-coding upstream 48546 2968657 ~ 2970230 (+)
G158676 NA non-coding upstream 110260 2908295 ~ 2908516 (+)
G158664 NA non-coding upstream 136620 2881841 ~ 2882156 (+)
G158660 NA non-coding upstream 141781 2876743 ~ 2876995 (+)
G158585 NA non-coding upstream 311615 2706948 ~ 2707161 (+)
CI01000030_03139836_03149991 NA non-coding downstream 107604 3139836 ~ 3150010 (+)
G158767 NA non-coding downstream 121049 3163243 ~ 3163472 (+)
CI01000030_03172301_03180142 NA non-coding downstream 130300 3172255 ~ 3180536 (+)
G158774 NA non-coding downstream 164804 3206998 ~ 3207286 (+)
G158766 NA non-coding downstream 169589 3211783 ~ 3212301 (+)
G158416 NA other upstream 404483 2595876 ~ 2614293 (+)
CI01000030_02277208_02282376 TM6SF2 other upstream 736406 2277208 ~ 2282743 (+)
G157726 NA other upstream 1380549 1636867 ~ 1638227 (+)
CI01000030_01003310_01003776 NA other upstream 2012089 1003114 ~ 1003795 (+)
G157227 NA other upstream 2662293 327649 ~ 356483 (+)
G159685 NA other downstream 1389606 4431800 ~ 4488526 (+)
G159816 NA other downstream 1474584 4516778 ~ 4517381 (+)
CI01000030_07200104_07202258 GCGA other downstream 4157741 7200104 ~ 7202485 (+)
CI01000030_07868597_07886123 NA other downstream 4811891 7868292 ~ 7886228 (+)
G162088 NA other downstream 5195771 8237965 ~ 8239604 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_020356 fgf22 coding NC_007133.7 CM002906.2 19111444 ~ 19156332 (+)
bowfin (Amia calva) AMCG00005892 fgf22,LOC106584266 coding CM030142.1 CM030142.1 12170080 ~ 12171314 (+)