G157501


Basic Information

Item Value
gene id G157501
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 1067162 ~ 1067470 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU178835
ATAAAAAATAAAAAATAAAAACATTCGTTTTTTATTTCCACACAAAGATGCGTCATATAGCCTACCGCTCTGCTCTTTGAGAGGGATGTGGGACACGAGCAGGAAAGAGACCATTTCTCTTTAATAATATCTTCATGTTATCCTCCTGATGTTACAAACAACTGACACTTGTTGTAAAAGGTCTGAAGAGCGAGTTTTATCCTCCGCAGGGGCAAGACATTCAGGCTATGTTTGATTTTGCGCTGCCAGAGAAAGTGAAAGTAAAAATCACCAGCGTGTGTGAAACGCGCTATACAAATAAACTTGACG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU178835 True 309 lncRNA 0.39 1 1067162 1067470

Neighbor

gene id symbol gene type direction distance location
CI01000030_01003310_01003776 NA coding upstream 63367 1003114 ~ 1003795 (+)
CI01000030_00945680_00950479 NA coding upstream 116246 945680 ~ 950916 (+)
CI01000030_00937645_00942188 LPL coding upstream 124340 937645 ~ 942822 (+)
CI01000030_00873074_00886771 GPC1A coding upstream 180355 871944 ~ 886807 (+)
CI01000030_00857611_00858359 NA coding upstream 208304 857470 ~ 858858 (+)
CI01000030_01091944_01093682 KLF2A coding downstream 24229 1091699 ~ 1094481 (+)
CI01000030_01134054_01144773 STIL coding downstream 66584 1134054 ~ 1145322 (+)
CI01000030_01151171_01165675 RC3H1A coding downstream 83460 1150930 ~ 1165939 (+)
CI01000030_01172285_01175092 SERPINC1 coding downstream 104725 1172195 ~ 1175095 (+)
CI01000030_01218528_01228673 DPH5 coding downstream 150061 1217531 ~ 1228693 (+)
G157484 NA non-coding upstream 16472 1050336 ~ 1050690 (+)
G157471 NA non-coding upstream 37352 1029252 ~ 1029810 (+)
G157456 NA non-coding upstream 52260 1014573 ~ 1014902 (+)
G157454 NA non-coding upstream 54475 1012432 ~ 1012687 (+)
G157337 NA non-coding upstream 82562 981501 ~ 984600 (+)
G157511 NA non-coding downstream 10977 1078447 ~ 1078676 (+)
G157535 NA non-coding downstream 28880 1096350 ~ 1096570 (+)
G157536 NA non-coding downstream 29263 1096733 ~ 1097008 (+)
G157525 NA non-coding downstream 30447 1097917 ~ 1099182 (+)
G157551 NA non-coding downstream 63649 1131119 ~ 1133120 (+)
G157227 NA other upstream 710679 327649 ~ 356483 (+)
G157108 NA other upstream 920309 116156 ~ 146853 (+)
G157076 NA other upstream 1049406 12878 ~ 17756 (+)
G157726 NA other downstream 569397 1636867 ~ 1638227 (+)
CI01000030_02277208_02282376 TM6SF2 other downstream 1211643 2277208 ~ 2282743 (+)
G158416 NA other downstream 1528406 2595876 ~ 2614293 (+)
CI01000030_03018776_03042194 FGF22 other downstream 1945986 3018776 ~ 3043773 (+)
G159685 NA other downstream 3364330 4431800 ~ 4488526 (+)

Expression


Co-expression Network