G158434



Basic Information


Item Value
gene id G158434
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 2655275 ~ 2655548 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU179904
ATGCGCGCAGCGAGCGTCCATCGCGAGGAATTCACCGCTCACATAAAACAGACAAACATCCGCGTCGCGTCCATCAGATGAATAGATCAATCTGCATTGTTTCTTGGACAGCTCGGACACAGGGCCTATTAGCCTCCAGGAAACACTCTCATCTTCTGGAGAAGTCATGGAGGTGGGTTAACTGGGTCATTAACGTGTTGTATTTATTGTATGATATAAACAACGCGATCTATTTCGGCTCACCGACAGTCGCTGATCTCACTGGGTTGTCGCT

Function


NR:

description
PREDICTED: actin, alpha cardiac-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU179904 True 274 lncRNA 0.49 1 2655275 2655548

Neighbor


gene id symbol gene type direction distance location
CI01000030_02641511_02650047 CILP2 coding upstream 4736 2641045 ~ 2650539 (+)
CI01000030_02620111_02632697 YJEFN3 coding upstream 22553 2620111 ~ 2632722 (+)
CI01000030_02573116_02582804 GATAD2A coding upstream 72463 2573116 ~ 2582812 (+)
CI01000030_02531026_02532411 NA coding upstream 121043 2530509 ~ 2534232 (+)
CI01000030_02472528_02477483 NA coding upstream 177792 2472528 ~ 2477483 (+)
CI01000030_02678940_02684491 NA coding downstream 23392 2678940 ~ 2684591 (+)
CI01000030_02705058_02731134 NA coding downstream 46263 2701811 ~ 2731151 (+)
CI01000030_02843446_02856037 CBARPB coding downstream 187898 2843446 ~ 2856216 (+)
CI01000030_02891265_02897170 FSTL3 coding downstream 235563 2891111 ~ 2898442 (+)
CI01000030_02911153_02916952 NA coding downstream 253852 2909400 ~ 2916952 (+)
G158436 NA non-coding upstream 2169 2652644 ~ 2653106 (+)
G158555 NA non-coding upstream 207823 2447009 ~ 2447452 (+)
G158548 NA non-coding upstream 228500 2426494 ~ 2426775 (+)
CI01000030_02423347_02426071 NA non-coding upstream 230200 2422768 ~ 2426301 (+)
G158566 NA non-coding downstream 1425 2656973 ~ 2657187 (+)
G158567 NA non-coding downstream 2714 2658262 ~ 2658521 (+)
G158398 NA non-coding downstream 31995 2687543 ~ 2690341 (+)
G158585 NA non-coding downstream 51400 2706948 ~ 2707161 (+)
G158416 NA other upstream 40982 2595876 ~ 2614293 (+)
CI01000030_02277208_02282376 TM6SF2 other upstream 372905 2277208 ~ 2282743 (+)
G157726 NA other upstream 1017048 1636867 ~ 1638227 (+)
CI01000030_01003310_01003776 NA other upstream 1648588 1003114 ~ 1003795 (+)
G157227 NA other upstream 2298792 327649 ~ 356483 (+)
CI01000030_03018776_03042194 FGF22 other downstream 357908 3018776 ~ 3043773 (+)
G159685 NA other downstream 1776252 4431800 ~ 4488526 (+)
G159816 NA other downstream 1861230 4516778 ~ 4517381 (+)
CI01000030_07200104_07202258 GCGA other downstream 4544387 7200104 ~ 7202485 (+)
CI01000030_07868597_07886123 NA other downstream 5198537 7868292 ~ 7886228 (+)

Expression



Co-expression Network