G158660


Basic Information

Item Value
gene id G158660
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 2876743 ~ 2876995 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU180141
CCACCCACAAGACCGTGAGCTGCCTGTCCATGCCTGTTCAGCAAAAACCAATGGTAAATAAAATAGCCTATATCATAATGTTAGGTGTAGTGCAAAGACCACTTATTTAGATTTTAAAAATATATTTCTCGTTAGTTTATTAGTACATTGTTGCCTTGCATTCATGTACATTAAGGTGCATGATATCATTAGAGCAGTTTACAATGTTGTTTCATCGCTCAAACAGGTTTTAAAATATTGCAGCGTCTGTGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU180141 True 253 lncRNA 0.36 1 2876743 2876995

Neighbor

gene id symbol gene type direction distance location
CI01000030_02843446_02856037 CBARPB coding upstream 20527 2843446 ~ 2856216 (+)
CI01000030_02705058_02731134 NA coding upstream 145592 2701811 ~ 2731151 (+)
CI01000030_02678940_02684491 NA coding upstream 192152 2678940 ~ 2684591 (+)
CI01000030_02641511_02650047 CILP2 coding upstream 226204 2641045 ~ 2650539 (+)
CI01000030_02620111_02632697 YJEFN3 coding upstream 244021 2620111 ~ 2632722 (+)
CI01000030_02891265_02897170 FSTL3 coding downstream 14116 2891111 ~ 2898442 (+)
CI01000030_02911153_02916952 NA coding downstream 32405 2909400 ~ 2916952 (+)
CI01000030_02919390_02954905 HCN2B, HCN2 coding downstream 42395 2919390 ~ 2955425 (+)
CI01000030_03018776_03042194 FGF22 coding downstream 141781 3018776 ~ 3043773 (+)
CI01000030_03058744_03059657 NA coding downstream 178876 3055871 ~ 3059667 (+)
G158585 NA non-coding upstream 169582 2706948 ~ 2707161 (+)
G158398 NA non-coding upstream 186402 2687543 ~ 2690341 (+)
G158567 NA non-coding upstream 218222 2658262 ~ 2658521 (+)
G158566 NA non-coding upstream 219556 2656973 ~ 2657187 (+)
G158664 NA non-coding downstream 4846 2881841 ~ 2882156 (+)
G158676 NA non-coding downstream 31300 2908295 ~ 2908516 (+)
G158681 NA non-coding downstream 91662 2968657 ~ 2970230 (+)
CI01000030_03139836_03149991 NA non-coding downstream 272803 3139836 ~ 3150010 (+)
G158767 NA non-coding downstream 286248 3163243 ~ 3163472 (+)
G158416 NA other upstream 262450 2595876 ~ 2614293 (+)
CI01000030_02277208_02282376 TM6SF2 other upstream 594373 2277208 ~ 2282743 (+)
G157726 NA other upstream 1238516 1636867 ~ 1638227 (+)
CI01000030_01003310_01003776 NA other upstream 1870056 1003114 ~ 1003795 (+)
G157227 NA other upstream 2520260 327649 ~ 356483 (+)
G159685 NA other downstream 1554805 4431800 ~ 4488526 (+)
G159816 NA other downstream 1639783 4516778 ~ 4517381 (+)
CI01000030_07200104_07202258 GCGA other downstream 4322940 7200104 ~ 7202485 (+)
CI01000030_07868597_07886123 NA other downstream 4977090 7868292 ~ 7886228 (+)

Expression


Co-expression Network