G159453


Basic Information

Item Value
gene id G159453
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 3644979 ~ 3645233 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU181023
TATGCCTTGAACTTTACACCCAGTAAAATGGAGGTTAATGGGCGATGGCTGTAAAAACTTGCCACTGTTTTCTGTTGAATTTAACTCACCGCAGTAGGTGTAAATGCTACTGTAGTCGAGAAAGCGCACGCGCAAGTTGTGAAGTACCGCTGGCTCATGGAGGAAGGTTAGAGCCGTGAGGTCATTCTCCCCCTCCAAAATATCAGGGTTACCTAGAGGGGGAAGACCTGCCGGAGGCAACACTGGATACTCCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU181023 True 255 lncRNA 0.49 1 3644979 3645233

Neighbor

gene id symbol gene type direction distance location
CI01000030_03594936_03629403 UNC13A coding upstream 15494 3594936 ~ 3629485 (+)
CI01000030_03580764_03584676 HMG20B coding upstream 59724 3580764 ~ 3585255 (+)
CI01000030_03565934_03569916 EEF2B, EEF2L2, EEF2.1.L, EF2, EEF2 coding upstream 74249 3565785 ~ 3570730 (+)
CI01000030_03253246_03261669 RGMD coding upstream 383036 3253246 ~ 3261943 (+)
CI01000030_03238201_03242662 NA coding upstream 402077 3237992 ~ 3242902 (+)
CI01000030_03703231_03704355 NA coding downstream 56940 3701601 ~ 3704615 (+)
CI01000030_03715463_03716370 NA coding downstream 69378 3714611 ~ 3717569 (+)
CI01000030_03744173_03745628 FOXQ2 coding downstream 98258 3743491 ~ 3745741 (+)
CI01000030_03765594_03778884 ONECUT3, ONECUT3A coding downstream 119829 3765062 ~ 3779032 (+)
CI01000030_03825765_03826754 NA coding downstream 180182 3825415 ~ 3826794 (+)
G159452 NA non-coding upstream 518 3643990 ~ 3644461 (+)
G159437 NA non-coding upstream 82686 3561516 ~ 3562293 (+)
G159434 NA non-coding upstream 97241 3547520 ~ 3547738 (+)
G159433 NA non-coding upstream 97949 3545393 ~ 3547030 (+)
G159420 NA non-coding upstream 111711 3532793 ~ 3533268 (+)
G159458 NA non-coding downstream 44816 3690049 ~ 3690431 (+)
G159459 NA non-coding downstream 45999 3691232 ~ 3691471 (+)
G159460 NA non-coding downstream 46600 3691833 ~ 3692126 (+)
G159461 NA non-coding downstream 47145 3692378 ~ 3692627 (+)
G159464 NA non-coding downstream 49422 3694655 ~ 3694895 (+)
CI01000030_03018776_03042194 FGF22 other upstream 601206 3018776 ~ 3043773 (+)
G158416 NA other upstream 1030686 2595876 ~ 2614293 (+)
CI01000030_02277208_02282376 TM6SF2 other upstream 1362609 2277208 ~ 2282743 (+)
G157726 NA other upstream 2006752 1636867 ~ 1638227 (+)
CI01000030_01003310_01003776 NA other upstream 2638292 1003114 ~ 1003795 (+)
G159685 NA other downstream 786567 4431800 ~ 4488526 (+)
G159816 NA other downstream 871545 4516778 ~ 4517381 (+)
CI01000030_07200104_07202258 GCGA other downstream 3554702 7200104 ~ 7202485 (+)
CI01000030_07868597_07886123 NA other downstream 4208852 7868292 ~ 7886228 (+)
G162088 NA other downstream 4592732 8237965 ~ 8239604 (+)

Expression


Co-expression Network