G159548


Basic Information

Item Value
gene id G159548
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 3811732 ~ 3811980 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU181120
CAAAAGCAGTGAACTAGAGCAAAAGCAGTGGTTTTGTAGAGGAAATAGCACAGAAGGATGCAGATGCGGTAGTAGGACCAGTGCCCGTGCACCAGCAGCAGCCTGTGGAGAAAGCTGAAATCTGCTTTGTGGACATTTAAATTTAAAAATTTGAGAATTTTAGATTAGTCTTTGCTTACCCATGTTTCACAGTTTGATCTCCATTCAGCTCATGAGCCCAATGGAACTTGGTGTCTCTGCAATTGAAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU181120 True 249 lncRNA 0.43 1 3811732 3811980

Neighbor

gene id symbol gene type direction distance location
CI01000030_03765594_03778884 ONECUT3, ONECUT3A coding upstream 32700 3765062 ~ 3779032 (+)
CI01000030_03744173_03745628 FOXQ2 coding upstream 65991 3743491 ~ 3745741 (+)
CI01000030_03715463_03716370 NA coding upstream 94163 3714611 ~ 3717569 (+)
CI01000030_03703231_03704355 NA coding upstream 107117 3701601 ~ 3704615 (+)
CI01000030_03594936_03629403 UNC13A coding upstream 182247 3594936 ~ 3629485 (+)
CI01000030_03825765_03826754 NA coding downstream 13435 3825415 ~ 3826794 (+)
CI01000030_03838027_03838812 NA coding downstream 24348 3836328 ~ 3840945 (+)
CI01000030_03909138_03910046 NA coding downstream 97058 3909038 ~ 3910046 (+)
CI01000030_03915675_03916993 NA coding downstream 103306 3915286 ~ 3916993 (+)
CI01000030_03917423_03918481 NA coding downstream 105443 3917423 ~ 3918674 (+)
G159547 NA non-coding upstream 518 3810733 ~ 3811214 (+)
G159546 NA non-coding upstream 1493 3809938 ~ 3810239 (+)
G159545 NA non-coding upstream 2085 3809424 ~ 3809647 (+)
G159483 NA non-coding upstream 48449 3763048 ~ 3763283 (+)
G159552 NA non-coding downstream 4782 3816762 ~ 3816999 (+)
G159553 NA non-coding downstream 7841 3819821 ~ 3820046 (+)
G159556 NA non-coding downstream 12307 3824287 ~ 3824551 (+)
G159561 NA non-coding downstream 31808 3843788 ~ 3843996 (+)
G159484 NA non-coding downstream 40012 3851992 ~ 3919867 (+)
CI01000030_03018776_03042194 FGF22 other upstream 767959 3018776 ~ 3043773 (+)
G158416 NA other upstream 1197439 2595876 ~ 2614293 (+)
CI01000030_02277208_02282376 TM6SF2 other upstream 1529362 2277208 ~ 2282743 (+)
G157726 NA other upstream 2173505 1636867 ~ 1638227 (+)
CI01000030_01003310_01003776 NA other upstream 2805045 1003114 ~ 1003795 (+)
G159685 NA other downstream 619820 4431800 ~ 4488526 (+)
G159816 NA other downstream 704798 4516778 ~ 4517381 (+)
CI01000030_07200104_07202258 GCGA other downstream 3387955 7200104 ~ 7202485 (+)
CI01000030_07868597_07886123 NA other downstream 4042105 7868292 ~ 7886228 (+)
G162088 NA other downstream 4425985 8237965 ~ 8239604 (+)

Expression


Co-expression Network