G159923


Basic Information

Item Value
gene id G159923
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 4872938 ~ 4873138 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU181548
CTGATCAATTTCCCAGTGGCTTATTGAATGTCTTTTAAATGGCTTTTTTATTTTCAATTATAACCCACTGTGTCTCGCCTGCCACAATGGGCCAACATTTGCACTGGTGGATAATTTAAAACCCTACTTTAGGAAATTATGCATTTTATATTGCCTAAATTTACAATCCCCTACCCAGTGCTGGTGTAGCGACAATAAAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU181548 True 201 lncRNA 0.37 1 4872938 4873138

Neighbor

gene id symbol gene type direction distance location
CI01000030_04822608_04834394 NA coding upstream 38538 4822608 ~ 4834400 (+)
CI01000030_04804199_04820916 KIF14 coding upstream 51672 4804199 ~ 4821266 (+)
CI01000030_04794796_04802874 DDX59 coding upstream 70006 4794642 ~ 4802932 (+)
CI01000030_04730959_04734987 NA coding upstream 137951 4729701 ~ 4734987 (+)
CI01000030_04708812_04716224 NA coding upstream 155235 4708577 ~ 4717703 (+)
CI01000030_04956344_04956706 NA coding downstream 83168 4956306 ~ 4957238 (+)
CI01000030_04965586_04966361 NA coding downstream 91667 4964805 ~ 4966394 (+)
CI01000030_05012841_05025567 NA coding downstream 139475 5012613 ~ 5026000 (+)
CI01000030_05136652_05140919 NA coding downstream 263372 5136510 ~ 5141441 (+)
CI01000030_05209012_05215995 NA coding downstream 335657 5208795 ~ 5216398 (+)
G159920 NA non-coding upstream 4157 4868578 ~ 4868781 (+)
G159917 NA non-coding upstream 14489 4858217 ~ 4858449 (+)
G159902 NA non-coding upstream 83648 4788905 ~ 4789290 (+)
G159892 NA non-coding upstream 88282 4770585 ~ 4784656 (+)
G159889 NA non-coding upstream 121692 4750641 ~ 4751246 (+)
G159933 NA non-coding downstream 18377 4891515 ~ 4891748 (+)
G159934 NA non-coding downstream 19886 4893024 ~ 4893361 (+)
G160005 NA non-coding downstream 127701 5000839 ~ 5001296 (+)
G159978 NA non-coding downstream 128806 5001944 ~ 5002162 (+)
G160037 NA non-coding downstream 166697 5039835 ~ 5040127 (+)
G159816 NA other upstream 355831 4516778 ~ 4517381 (+)
G159685 NA other upstream 384412 4431800 ~ 4488526 (+)
CI01000030_03018776_03042194 FGF22 other upstream 1829165 3018776 ~ 3043773 (+)
G158416 NA other upstream 2258645 2595876 ~ 2614293 (+)
CI01000030_02277208_02282376 TM6SF2 other upstream 2590568 2277208 ~ 2282743 (+)
CI01000030_07200104_07202258 GCGA other downstream 2326797 7200104 ~ 7202485 (+)
CI01000030_07868597_07886123 NA other downstream 2980947 7868292 ~ 7886228 (+)
G162088 NA other downstream 3364827 8237965 ~ 8239604 (+)
G161986 NA other downstream 3671444 8544582 ~ 8548325 (+)
G162137 NA other downstream 3694872 8568010 ~ 8571726 (+)

Expression


Co-expression Network