G161949


Basic Information

Item Value
gene id G161949
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 7845492 ~ 7845741 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU183864
AGAGCACATTTGTTATGGCCAGAGAAACTATGATCTGGGCTGCATTTCCCAAAAGTGTTGTAAGCCAAAGTTGATCAACTTATGTTTACGATGCTTTGGGAAGCACAGTTATAACAGTTGTGTTTTCATGATGACATTTTCATTGTGAAATGGCCTGTTTTGTTGGTGACATCCTGTATTGTTAACTGGTCACATAGATGTTCTATTATTTCTTCACACTAAATCAGTTACCACTTGAGATCCAGTAGAG

Function

NR:

description
sorting and assembly machinery component 50 homolog A-like isoform X1

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU183864 True 250 lncRNA 0.38 1 7845492 7845741

Neighbor

gene id symbol gene type direction distance location
CI01000030_07842295_07842928 NA coding upstream 2564 7842036 ~ 7842928 (+)
CI01000030_07829863_07839971 BAP1 coding upstream 4618 7829863 ~ 7840874 (+)
CI01000030_07804997_07807303 NA coding upstream 37576 7804662 ~ 7807916 (+)
CI01000030_07759509_07760589 NA coding upstream 84610 7758805 ~ 7760882 (+)
CI01000030_07738356_07746377 SASS6 coding upstream 99046 7738356 ~ 7746446 (+)
CI01000030_07868597_07886123 NA coding downstream 22551 7868292 ~ 7886228 (+)
CI01000030_07899071_07899829 NA coding downstream 53330 7899071 ~ 7900320 (+)
CI01000030_07903607_07912664 IPPK coding downstream 57866 7903607 ~ 7913309 (+)
CI01000030_07924704_07945878 ECM2, OMD coding downstream 78963 7924704 ~ 7945939 (+)
CI01000030_07954583_07955459 NA coding downstream 108842 7954583 ~ 7956474 (+)
G161937 NA non-coding upstream 40952 7804286 ~ 7804540 (+)
G161936 NA non-coding upstream 41386 7803825 ~ 7804106 (+)
G161935 NA non-coding upstream 42013 7802938 ~ 7803479 (+)
G161913 NA non-coding upstream 43573 7801434 ~ 7801919 (+)
G161933 NA non-coding upstream 45464 7799801 ~ 7800028 (+)
G161950 NA non-coding downstream 455 7846196 ~ 7846757 (+)
G161953 NA non-coding downstream 9886 7855627 ~ 7858263 (+)
G161954 NA non-coding downstream 14173 7859914 ~ 7873188 (+)
G161956 NA non-coding downstream 15441 7861182 ~ 7861688 (+)
G161974 NA non-coding downstream 140815 7986556 ~ 7988149 (+)
CI01000030_07200104_07202258 GCGA other upstream 643007 7200104 ~ 7202485 (+)
G159816 NA other upstream 3328385 4516778 ~ 4517381 (+)
G159685 NA other upstream 3356966 4431800 ~ 4488526 (+)
CI01000030_03018776_03042194 FGF22 other upstream 4801719 3018776 ~ 3043773 (+)
G158416 NA other upstream 5231199 2595876 ~ 2614293 (+)
G162088 NA other downstream 392224 8237965 ~ 8239604 (+)
G161986 NA other downstream 698841 8544582 ~ 8548325 (+)
G162137 NA other downstream 722269 8568010 ~ 8571726 (+)
G162449 NA other downstream 1510662 9356403 ~ 9357014 (+)

Expression


Co-expression Network