G162097


Basic Information

Item Value
gene id G162097
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 8270074 ~ 8270414 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU184063
GGAAACACGTGAGGTAGAGGAGAAACTGCAGATCTGTATTTGTGCGTCAATAGAAGTTTAGTATTTTTATCTTGGTCTGTCACTGTTTCACTTACCAAACCGCATCCTGGGTCAGAGGGATCAAGGCAGACCATGTGAAATGACAGAGTGCTTTAAAAAGACCCAGCTTCCTGTGACAGTAAAGTGAAGTCTACCATGTTTGTCCTTTCCTCTACAAATATTGACTTTGTCTCTGTTCAAAGAAAGCACACAACTGAGGGAACAATGCAGAGTGTAGATTCCCAGCAAAGACTGACACACAAAAGTGATAAATCCTAGTTTGTATTCAGTCCTATCAGCCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU184063 True 341 lncRNA 0.42 1 8270074 8270414

Neighbor

gene id symbol gene type direction distance location
CI01000030_08168074_08174577 NA coding upstream 95412 8167927 ~ 8174662 (+)
CI01000030_08159242_08166884 GLS2B coding upstream 103129 8159242 ~ 8166945 (+)
CI01000030_08155452_08158318 RDH5 coding upstream 111365 8155452 ~ 8158709 (+)
CI01000030_08150901_08154024 GM7936 coding upstream 116050 8150901 ~ 8154024 (+)
CI01000030_08133065_08140755 RBCK1 coding upstream 129076 8133065 ~ 8140998 (+)
CI01000030_08555726_08559327 MMYHEMB1 coding downstream 284965 8555379 ~ 8559397 (+)
CI01000030_08763819_08775586 NA coding downstream 493316 8763730 ~ 8775772 (+)
CI01000030_08837486_08838040 NA coding downstream 566807 8837221 ~ 8838451 (+)
CI01000030_08845484_08861801 NA coding downstream 575070 8845484 ~ 8861801 (+)
CI01000030_08862264_08875155 NA coding downstream 591850 8862264 ~ 8875155 (+)
G162092 NA non-coding upstream 19772 8249998 ~ 8250302 (+)
G162091 NA non-coding upstream 20182 8249678 ~ 8249892 (+)
G162087 NA non-coding upstream 32391 8237338 ~ 8237683 (+)
G162080 NA non-coding upstream 72046 8197744 ~ 8198028 (+)
G162074 NA non-coding upstream 82479 8187380 ~ 8187595 (+)
G162103 NA non-coding downstream 12645 8283059 ~ 8283528 (+)
G162105 NA non-coding downstream 29207 8299621 ~ 8299855 (+)
G162108 NA non-coding downstream 76510 8346924 ~ 8347253 (+)
G162008 NA non-coding downstream 78987 8349401 ~ 8350756 (+)
G162110 NA non-coding downstream 92729 8363143 ~ 8363451 (+)
G162088 NA other upstream 30470 8237965 ~ 8239604 (+)
CI01000030_07868597_07886123 NA other upstream 397302 7868292 ~ 7886228 (+)
CI01000030_07200104_07202258 GCGA other upstream 1067589 7200104 ~ 7202485 (+)
G159816 NA other upstream 3752967 4516778 ~ 4517381 (+)
G159685 NA other upstream 3781548 4431800 ~ 4488526 (+)
G161986 NA other downstream 274168 8544582 ~ 8548325 (+)
G162137 NA other downstream 297596 8568010 ~ 8571726 (+)
G162449 NA other downstream 1085989 9356403 ~ 9357014 (+)
CI01000030_10039688_10047019 NA other downstream 1772379 10039358 ~ 10047210 (+)
G162297 NA other downstream 1862885 10133299 ~ 10221224 (+)

Expression


Co-expression Network