G162016


Basic Information

Item Value
gene id G162016
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 8477767 ~ 8529751 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU183957
ATGATTGCTCCTTTCAGTCAGACTTCATCTTGACAGTACTGTACATTTCAAAAGCAAATAAGTTGAAAATGTTGCTGCTGACGTACCTGAACATGACCGACAGAGTTGAGTGATGTCCAGATGTTGAGTCTGGTTGCTGATGGGATTGTTGATCACACAGCTGTAGGTGTTGTTATCCTGATATTCCACCTCCAGAGGTAGAGAGAGACTGATGCTGAGATCAGACACATTGATGCTGGACAATAAACTGTTTCCTTTGTACCAGGAGAGAGTCACATGACTCACATTCAACACTGAACACAGCAGTGAACAATTGGACACTGATGATCCTGATGAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU183957 True 337 lncRNA 0.43 2 8477767 8529751

Neighbor

gene id symbol gene type direction distance location
CI01000030_08168074_08174577 NA coding upstream 303105 8167927 ~ 8174662 (+)
CI01000030_08159242_08166884 GLS2B coding upstream 310822 8159242 ~ 8166945 (+)
CI01000030_08155452_08158318 RDH5 coding upstream 319058 8155452 ~ 8158709 (+)
CI01000030_08150901_08154024 GM7936 coding upstream 323743 8150901 ~ 8154024 (+)
CI01000030_08133065_08140755 RBCK1 coding upstream 336769 8133065 ~ 8140998 (+)
CI01000030_08555726_08559327 MMYHEMB1 coding downstream 25628 8555379 ~ 8559397 (+)
CI01000030_08763819_08775586 NA coding downstream 233979 8763730 ~ 8775772 (+)
CI01000030_08837486_08838040 NA coding downstream 307470 8837221 ~ 8838451 (+)
CI01000030_08845484_08861801 NA coding downstream 315733 8845484 ~ 8861801 (+)
CI01000030_08862264_08875155 NA coding downstream 332513 8862264 ~ 8875155 (+)
G161988 NA non-coding upstream 11483 8463777 ~ 8466284 (+)
G162117 NA non-coding upstream 26140 8450792 ~ 8451627 (+)
G162116 NA non-coding upstream 27097 8449923 ~ 8450670 (+)
G162019 NA non-coding upstream 37027 8437635 ~ 8440740 (+)
G161984 NA non-coding upstream 78132 8396642 ~ 8399635 (+)
G162138 NA non-coding downstream 33366 8563117 ~ 8564920 (+)
G162142 NA non-coding downstream 65067 8594818 ~ 8596250 (+)
G162143 NA non-coding downstream 66590 8596341 ~ 8596770 (+)
G162145 NA non-coding downstream 67383 8597134 ~ 8599811 (+)
G162088 NA other upstream 238163 8237965 ~ 8239604 (+)
CI01000030_07868597_07886123 NA other upstream 604995 7868292 ~ 7886228 (+)
CI01000030_07200104_07202258 GCGA other upstream 1275282 7200104 ~ 7202485 (+)
G159816 NA other upstream 3960660 4516778 ~ 4517381 (+)
G159685 NA other upstream 3989241 4431800 ~ 4488526 (+)
G161986 NA other downstream 14831 8544582 ~ 8548325 (+)
G162137 NA other downstream 38259 8568010 ~ 8571726 (+)
G162449 NA other downstream 826652 9356403 ~ 9357014 (+)
CI01000030_10039688_10047019 NA other downstream 1513042 10039358 ~ 10047210 (+)
G162297 NA other downstream 1603548 10133299 ~ 10221224 (+)

Expression


Co-expression Network