G162257


Basic Information

Item Value
gene id G162257
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 8949464 ~ 8949693 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU184269
TGATAATCAGCTGTGGGCCTCATCATCACAGCTATTGATTCAGTCAGTGACAGCGACACCCAGCGTTAGCCAATACTGTCACAAACCTGGATTAAAATGCACTCAGTGTAATTTCATGGGTGGGTTCCCTTTCACCCCTCGGCTGTGAGTTTCTCAAATAATACTGATCAGTCTTTCCGTACATGTTCATTTATCACTCAAGCACCTCCTGGTCAGCAGGACTGTCCGTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU184269 True 230 lncRNA 0.46 1 8949464 8949693

Neighbor

gene id symbol gene type direction distance location
CI01000030_08906500_08914084 NA coding upstream 35380 8906500 ~ 8914084 (+)
CI01000030_08889890_08899808 NA coding upstream 48784 8889890 ~ 8900680 (+)
CI01000030_08875265_08877569 NA coding upstream 71895 8875265 ~ 8877569 (+)
CI01000030_08862264_08875155 NA coding upstream 74309 8862264 ~ 8875155 (+)
CI01000030_08845484_08861801 NA coding upstream 87663 8845484 ~ 8861801 (+)
CI01000030_08951137_08953545 NA coding downstream 285 8949978 ~ 8953663 (+)
CI01000030_08970358_08975052 NA coding downstream 19699 8969392 ~ 8975093 (+)
CI01000030_09065536_09066102 NA coding downstream 115445 9065138 ~ 9066149 (+)
CI01000030_09086896_09146359 ASIC1, ASIC1B coding downstream 137203 9086896 ~ 9146359 (+)
CI01000030_09158208_09166948 SMARCD1.L, SMARCD1 coding downstream 208515 9158208 ~ 9168173 (+)
G162256 NA non-coding upstream 1124 8947858 ~ 8948340 (+)
G162255 NA non-coding upstream 1766 8946558 ~ 8947698 (+)
G162254 NA non-coding upstream 3127 8946122 ~ 8946337 (+)
G162186 NA non-coding upstream 18942 8865175 ~ 8930522 (+)
G162236 NA non-coding upstream 138009 8809324 ~ 8811455 (+)
G162202 NA non-coding downstream 82184 9031877 ~ 9039588 (+)
G162190 NA non-coding downstream 200013 9149706 ~ 9150384 (+)
G162389 NA non-coding downstream 250541 9200234 ~ 9242739 (+)
G162432 NA non-coding downstream 285871 9235564 ~ 9236563 (+)
G162438 NA non-coding downstream 331835 9281528 ~ 9281835 (+)
G162137 NA other upstream 377738 8568010 ~ 8571726 (+)
G161986 NA other upstream 401139 8544582 ~ 8548325 (+)
G162088 NA other upstream 709860 8237965 ~ 8239604 (+)
CI01000030_07868597_07886123 NA other upstream 1076692 7868292 ~ 7886228 (+)
CI01000030_07200104_07202258 GCGA other upstream 1746979 7200104 ~ 7202485 (+)
G162449 NA other downstream 406710 9356403 ~ 9357014 (+)
CI01000030_10039688_10047019 NA other downstream 1093100 10039358 ~ 10047210 (+)
G162297 NA other downstream 1183606 10133299 ~ 10221224 (+)
CI01000030_10473378_10509560 NA other downstream 1541753 10471835 ~ 10511071 (+)
CI01000030_10738658_10751094 NA other downstream 1788888 10738087 ~ 10751548 (+)

Expression


Co-expression Network