G162454


Basic Information

Item Value
gene id G162454
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 9389140 ~ 9389367 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU184493
TCAAAGATAGATGAGATTAGATACAGAATGTGTTGTTTTGAGAATATTGCAGATCTTGCATTATTTCATGTCTGCAGAAATGGAAATATGTTGATACAAAGGTACATCACCTAATGAATTCCAATGGAAAATACACCCACTCAATCTTACAGCACAGAAGAGACACCAAAAGATCTTACATTTGGAAATATTCAAACATATCAGAGCATATAGTAGGAAACATATAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU184493 True 228 lncRNA 0.32 1 9389140 9389367

Neighbor

gene id symbol gene type direction distance location
CI01000030_09361364_09379014 NA coding upstream 9419 9361035 ~ 9379721 (+)
CI01000030_09321409_09339033 NA coding upstream 49176 9321340 ~ 9339964 (+)
CI01000030_09308467_09315467 NA coding upstream 73080 9307812 ~ 9316060 (+)
CI01000030_09300172_09306760 NA coding upstream 81766 9299805 ~ 9307374 (+)
CI01000030_09259092_09261043 NA coding upstream 128097 9258216 ~ 9261043 (+)
CI01000030_09509234_09514703 NA coding downstream 119222 9508589 ~ 9516002 (+)
CI01000030_09526436_09552770 NA coding downstream 136888 9526255 ~ 9554552 (+)
CI01000030_09598376_09634083 NA coding downstream 208787 9598154 ~ 9634480 (+)
CI01000030_09691687_09697272 NA coding downstream 301429 9690796 ~ 9697492 (+)
CI01000030_09724422_09740444 NA coding downstream 334988 9724355 ~ 9740578 (+)
G162452 NA non-coding upstream 6634 9382278 ~ 9382506 (+)
G162449 NA non-coding upstream 32126 9356403 ~ 9357014 (+)
G162318 NA non-coding upstream 55236 9331446 ~ 9333904 (+)
G162441 NA non-coding upstream 104529 9284384 ~ 9284611 (+)
G162459 NA non-coding downstream 12483 9401850 ~ 9402063 (+)
G162460 NA non-coding downstream 16038 9405405 ~ 9405644 (+)
G162463 NA non-coding downstream 28165 9417532 ~ 9417856 (+)
G162465 NA non-coding downstream 30562 9419929 ~ 9420133 (+)
G162469 NA non-coding downstream 50425 9439792 ~ 9440117 (+)
G162137 NA other upstream 817414 8568010 ~ 8571726 (+)
G161986 NA other upstream 840815 8544582 ~ 8548325 (+)
G162088 NA other upstream 1149536 8237965 ~ 8239604 (+)
CI01000030_07868597_07886123 NA other upstream 1516368 7868292 ~ 7886228 (+)
CI01000030_10039688_10047019 NA other downstream 653426 10039358 ~ 10047210 (+)
G162297 NA other downstream 743932 10133299 ~ 10221224 (+)
CI01000030_10473378_10509560 NA other downstream 1102079 10471835 ~ 10511071 (+)
CI01000030_10738658_10751094 NA other downstream 1349214 10738087 ~ 10751548 (+)
G162821 NA other downstream 1476645 10866012 ~ 10868440 (+)

Expression


Co-expression Network