G162460


Basic Information

Item Value
gene id G162460
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 9405405 ~ 9405644 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU184500
CAAATGGTTTGTAGGTGAGAGTGGGTATTTGATGCATCTGTGTTTAGTTTGTAGGTGAAGAGCTTCTTCCTGTCCTGCTTTAAATGAACCTCACAGTTGATGCCCTATAAAACAGCTTTACAGTCAAATAACATACTGAATCCATCAAAAAGTCAAATCAGAGGTCAACTAGACTCTTACCTATCATGCGTCTTTGATAACATACACAGATTGACAGCTAAACAAAATGCTAAATAATAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU184500 True 240 lncRNA 0.37 1 9405405 9405644

Neighbor

gene id symbol gene type direction distance location
CI01000030_09361364_09379014 NA coding upstream 25684 9361035 ~ 9379721 (+)
CI01000030_09321409_09339033 NA coding upstream 65441 9321340 ~ 9339964 (+)
CI01000030_09308467_09315467 NA coding upstream 89345 9307812 ~ 9316060 (+)
CI01000030_09300172_09306760 NA coding upstream 98031 9299805 ~ 9307374 (+)
CI01000030_09259092_09261043 NA coding upstream 144362 9258216 ~ 9261043 (+)
CI01000030_09509234_09514703 NA coding downstream 102945 9508589 ~ 9516002 (+)
CI01000030_09526436_09552770 NA coding downstream 120611 9526255 ~ 9554552 (+)
CI01000030_09598376_09634083 NA coding downstream 192510 9598154 ~ 9634480 (+)
CI01000030_09691687_09697272 NA coding downstream 285152 9690796 ~ 9697492 (+)
CI01000030_09724422_09740444 NA coding downstream 318711 9724355 ~ 9740578 (+)
G162459 NA non-coding upstream 3342 9401850 ~ 9402063 (+)
G162454 NA non-coding upstream 16038 9389140 ~ 9389367 (+)
G162452 NA non-coding upstream 22899 9382278 ~ 9382506 (+)
G162449 NA non-coding upstream 48391 9356403 ~ 9357014 (+)
G162318 NA non-coding upstream 71501 9331446 ~ 9333904 (+)
G162463 NA non-coding downstream 11888 9417532 ~ 9417856 (+)
G162465 NA non-coding downstream 14285 9419929 ~ 9420133 (+)
G162469 NA non-coding downstream 34148 9439792 ~ 9440117 (+)
G162474 NA non-coding downstream 58586 9464230 ~ 9467396 (+)
G162483 NA non-coding downstream 80822 9486466 ~ 9487179 (+)
G162137 NA other upstream 833679 8568010 ~ 8571726 (+)
G161986 NA other upstream 857080 8544582 ~ 8548325 (+)
G162088 NA other upstream 1165801 8237965 ~ 8239604 (+)
CI01000030_07868597_07886123 NA other upstream 1532633 7868292 ~ 7886228 (+)
CI01000030_10039688_10047019 NA other downstream 637149 10039358 ~ 10047210 (+)
G162297 NA other downstream 727655 10133299 ~ 10221224 (+)
CI01000030_10473378_10509560 NA other downstream 1085802 10471835 ~ 10511071 (+)
CI01000030_10738658_10751094 NA other downstream 1332937 10738087 ~ 10751548 (+)
G162821 NA other downstream 1460368 10866012 ~ 10868440 (+)

Expression


Co-expression Network