G162399


Basic Information

Item Value
gene id G162399
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 9833678 ~ 9837829 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU184429
AAATAATCACATATATCAGCGCTGTCGTACCTGCACATGTGTGACAGAGTTGAGTGATGTCCAGATGTTGAGTCTGGTTGCTGATGGGATTGTTCAGCACACAGCTGTAGGTGTTGTTATCCTGATATTCCACCTCCAGAGGTAGAGAGAGACTGATGCTGAGATCAGACACACTGATGCTGGACAATAAACTGTTTCCTTTGTACCAGGAGAGAGTCACATGACTCACATTCACAGCTGAACACACCAATGAACAATTTGATGATGATGATGATGAAGAACATTGTGAAGAGTTACTGATGATGACAGGAACAGGCAGACGAGCTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU184429 True 327 lncRNA 0.44 2 9833678 9837829

Neighbor

gene id symbol gene type direction distance location
CI01000030_09799840_09805801 NA coding upstream 27859 9798003 ~ 9805819 (+)
CI01000030_09754796_09761721 NA coding upstream 69936 9754573 ~ 9763742 (+)
CI01000030_09724422_09740444 NA coding upstream 93100 9724355 ~ 9740578 (+)
CI01000030_09691687_09697272 NA coding upstream 136186 9690796 ~ 9697492 (+)
CI01000030_09598376_09634083 NA coding upstream 199198 9598154 ~ 9634480 (+)
CI01000030_09847512_09854804 NA coding downstream 9593 9847422 ~ 9855676 (+)
CI01000030_09876738_09883981 NA coding downstream 37456 9875285 ~ 9884005 (+)
CI01000030_09922237_09930221 NA coding downstream 84220 9922049 ~ 9930368 (+)
CI01000030_09989586_10008913 NA coding downstream 151538 9989367 ~ 10009155 (+)
CI01000030_10039688_10047019 NA coding downstream 201529 10039358 ~ 10047210 (+)
G162539 NA non-coding upstream 11663 9812537 ~ 9822015 (+)
G162359 NA non-coding upstream 117022 9711018 ~ 9716656 (+)
G162530 NA non-coding upstream 150014 9682368 ~ 9683664 (+)
G162335 NA non-coding upstream 185104 9638538 ~ 9648574 (+)
G162550 NA non-coding downstream 21662 9859491 ~ 9863964 (+)
G162563 NA non-coding downstream 104059 9941888 ~ 9965500 (+)
G162572 NA non-coding downstream 137488 9975317 ~ 10038293 (+)
G162574 NA non-coding downstream 144882 9982711 ~ 10019123 (+)
G162449 NA other upstream 476664 9356403 ~ 9357014 (+)
G162137 NA other upstream 1261952 8568010 ~ 8571726 (+)
G161986 NA other upstream 1285353 8544582 ~ 8548325 (+)
G162088 NA other upstream 1594074 8237965 ~ 8239604 (+)
CI01000030_07868597_07886123 NA other upstream 1960906 7868292 ~ 7886228 (+)
G162297 NA other downstream 295470 10133299 ~ 10221224 (+)
CI01000030_10473378_10509560 NA other downstream 653617 10471835 ~ 10511071 (+)
CI01000030_10738658_10751094 NA other downstream 900752 10738087 ~ 10751548 (+)
G162821 NA other downstream 1028183 10866012 ~ 10868440 (+)

Expression


Co-expression Network