G162583


Basic Information

Item Value
gene id G162583
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 10017898 ~ 10081460 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU184659
CTGCACATGTGTGACAGAGTTGAGTGATGTCCAGATGTTGAGTCTGGTGTCTGATGGGATTGTTCAGCACACAGCTGTAGGTGTTGTTATCCTGATATTCCACCTCCAGAGGTAGAGAGAGACTGATGCTGAGATCAGACACACTGATGCTGGACAATAAACTGTTTCCTTTGTACCAGGAGAGAGTCACATGACTCACATTCACAGCTGAACACACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU184659 True 218 lncRNA 0.47 2 10017898 10081460

Neighbor

gene id symbol gene type direction distance location
CI01000030_09989586_10008913 NA coding upstream 8743 9989367 ~ 10009155 (+)
CI01000030_09922237_09930221 NA coding upstream 87530 9922049 ~ 9930368 (+)
CI01000030_09876738_09883981 NA coding upstream 133893 9875285 ~ 9884005 (+)
CI01000030_09847512_09854804 NA coding upstream 162222 9847422 ~ 9855676 (+)
CI01000030_09799840_09805801 NA coding upstream 212079 9798003 ~ 9805819 (+)
CI01000030_10099125_10101681 NA coding downstream 17498 10098958 ~ 10102160 (+)
CI01000030_10134835_10135293 NA coding downstream 53375 10134835 ~ 10136130 (+)
CI01000030_10140982_10145096 NA coding downstream 58423 10139883 ~ 10145189 (+)
CI01000030_10148536_10153337 NA coding downstream 65757 10147217 ~ 10153439 (+)
CI01000030_10164557_10167430 NA coding downstream 82904 10164364 ~ 10169382 (+)
G162563 NA non-coding upstream 52398 9941888 ~ 9965500 (+)
G162550 NA non-coding upstream 153934 9859491 ~ 9863964 (+)
G162546 NA non-coding upstream 160183 9830419 ~ 9857715 (+)
G162350 NA non-coding downstream 6456 10087916 ~ 10095595 (+)
G162605 NA non-coding downstream 25268 10106728 ~ 10404016 (+)
G162334 NA non-coding downstream 34230 10115690 ~ 10131571 (+)
G162634 NA non-coding downstream 112637 10194097 ~ 10195201 (+)
G162633 NA non-coding downstream 147184 10228644 ~ 10238283 (+)
G162449 NA other upstream 660884 9356403 ~ 9357014 (+)
G162137 NA other upstream 1446172 8568010 ~ 8571726 (+)
G161986 NA other upstream 1469573 8544582 ~ 8548325 (+)
G162088 NA other upstream 1778294 8237965 ~ 8239604 (+)
CI01000030_07868597_07886123 NA other upstream 2145126 7868292 ~ 7886228 (+)
G162297 NA other downstream 51839 10133299 ~ 10221224 (+)
CI01000030_10473378_10509560 NA other downstream 409986 10471835 ~ 10511071 (+)
CI01000030_10738658_10751094 NA other downstream 657121 10738087 ~ 10751548 (+)
G162821 NA other downstream 784552 10866012 ~ 10868440 (+)
CI01000030_11362386_11380216 CALR3A, CALR3, CALR3B other downstream 1259295 11362114 ~ 11380772 (+)

Expression


Co-expression Network