G162855


Basic Information

Item Value
gene id G162855
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 10974761 ~ 10975108 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU184965
CAAAAGTTTAATAGGCTGATGGTTTTTATTAGGGACATGACGGGAAGTATATCTTATTTTATATATTTTTGAAGCATTAAATGTTCTGATTTTATTTCCTAGGAAAGGATATGTACTGTATTCCTCAAAGGTATATATTGCAACACAATATACAAATGTTTTTCATTATAAAAGAGTTGGAAAGTAGCCCAGGTCTTTGTTTACTTAAAGTCCCCTTATAGTCAATAATTTTATCCCTTAAAACTCATCTTTGATTACCAAAGTGATTTTTCGCTGTAAAATAGCCTGACCCTTGCTTCATTCAATATATGCAGATCTATGAATATGCTAAGCCCCGCCTCCACTCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU184965 True 348 lncRNA 0.32 1 10974761 10975108

Neighbor

gene id symbol gene type direction distance location
CI01000030_10968005_10969830 NA coding upstream 4710 10967106 ~ 10970051 (+)
CI01000030_10958494_10960930 TNFAIP8L1 coding upstream 12557 10957157 ~ 10962204 (+)
CI01000030_10936461_10939911 NA coding upstream 33971 10936461 ~ 10940790 (+)
CI01000030_10911224_10918511 NA coding upstream 55832 10908366 ~ 10918929 (+)
CI01000030_10860938_10862107 S1PR4 coding upstream 112469 10860768 ~ 10862292 (+)
CI01000030_10993343_11015527 ZFR2 coding downstream 18235 10993343 ~ 11015855 (+)
CI01000030_11017331_11024754 MATK coding downstream 42223 11017331 ~ 11025102 (+)
CI01000030_11035570_11040272 RX1, RAX2 coding downstream 60149 11035257 ~ 11041233 (+)
CI01000030_11047852_11057798 CHERP coding downstream 72654 11047762 ~ 11057798 (+)
CI01000030_11067119_11069478 NA coding downstream 91926 11067034 ~ 11069525 (+)
G162830 NA non-coding upstream 76313 10896840 ~ 10898448 (+)
G162827 NA non-coding upstream 92180 10882356 ~ 10882581 (+)
G162822 NA non-coding upstream 103581 10870534 ~ 10871180 (+)
G162819 NA non-coding upstream 117669 10856858 ~ 10857092 (+)
G162859 NA non-coding downstream 6390 10981498 ~ 10982379 (+)
G162762 NA non-coding downstream 78165 11053273 ~ 11091871 (+)
G162875 NA non-coding downstream 128229 11103337 ~ 11103651 (+)
G162892 NA non-coding downstream 240879 11215987 ~ 11234587 (+)
G162891 NA non-coding downstream 250552 11225660 ~ 11252096 (+)
G162821 NA other upstream 106321 10866012 ~ 10868440 (+)
CI01000030_10738658_10751094 NA other upstream 234210 10738087 ~ 10751548 (+)
CI01000030_10473378_10509560 NA other upstream 473118 10471835 ~ 10511071 (+)
G162297 NA other upstream 753537 10133299 ~ 10221224 (+)
CI01000030_10039688_10047019 NA other upstream 928878 10039358 ~ 10047210 (+)
CI01000030_11362386_11380216 CALR3A, CALR3, CALR3B other downstream 365647 11362114 ~ 11380772 (+)
G162951 NA other downstream 517493 11492601 ~ 11496119 (+)

Expression


Co-expression Network