CI01000034_00599073_00603301 (UBE2I, GM14176, UBE2IA, GM5931, UBE2IB)


Basic Information

Item Value
gene id CI01000034_00599073_00603301
gene name UBE2I, GM14176, UBE2IA, GM5931, UBE2IB
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 599073 ~ 603301 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000034_00599073_00603301.mRNA
GGTTTTGTGGCTGTACCAACCAAGAACCCGGATGGCACCATGAATCTCATGAATTGGGAGTGTGCGATACCAGGAAAAAAGGGGACTCTTTGGGAGGGAGGTTTGTACAAACTCAGAATGTTCTTTAAGGATGATTACCCATCTTCACCACCCAAATGCAAGTTTGAACCTCCGATCTTCCACCCAAACGTCTATCCTTCAGGTACAGTCTGTCTGTCCATACTGGAGGAAGAGAAGGATTGGAGACCAGCCATCACCATCAAACAAATTTTGTTGGGCATCCAGGAACTCCTTAATGAGCCCAACATTCAGGACCCAGCGCAGGCAGAGGCATATACAACATACTGTTTCGTCATATTACTGAATTACCCTGCATGTATTCACACTGTTTTACTTGGAACTTTGAATCTTGATTTCCAAACATGTTTATACTTATTGATAGGACAATTTGAGGATGAGCACCAACAGCCAATCAGAGAAGAGGAAAAACGGCTGCAATCAGGTCCGTTCTGCTTCACAACATTGAACATTTTAGAATCTGTTGCACTGGTGTGCAGAGTGCACTGCCCACAAGTTCCATCCCTTTGCGCTCCTCATTACTCTGATACAAACTCAGATAGCACAGATGAGCACAGATCCTATCATATGCTGGGCCACTATCTGCGCGCAAACGTTGTCCCTGGGCCCTCGGTTGTGTGGTCATCTTTGGTGAAGGACTCATATACTCATCATCATCTACCAGCATTTATCCAAGATGCAGAGCACTGGCACGGCCACAAAACGGATCACCTCG

Function

symbol description
ube2ib Enables SUMO transferase activity. Acts upstream of or within several processes, including embryonic heart tube development; hematopoietic stem cell homeostasis; and protein sumoylation. Predicted to be active in nucleus. Is expressed in several structures, including immature eye; nervous system; neural crest; pectoral fin bud; and pharyngeal pouch. Orthologous to human UBE2I (ubiquitin conjugating enzyme E2 I).
ube2ia Predicted to enable SUMO conjugating enzyme activity. Acts upstream of or within definitive hemopoiesis; embryonic heart tube elongation; and heart looping. Predicted to be active in nucleus. Orthologous to human UBE2I (ubiquitin conjugating enzyme E2 I).
ube2i Enables several functions, including RING-like zinc finger domain binding activity; SUMO conjugating enzyme activity; and small protein activating enzyme binding activity. Involved in negative regulation of transcription by RNA polymerase II; positive regulation of SUMO transferase activity; and protein sumoylation. Located in PML body and cytoplasm. Part of sumoylated E2 ligase complex and transferase complex. Biomarker of dilated cardiomyopathy; ovarian cancer; and urinary bladder cancer.

GO:

id name namespace
GO:0008766 UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diaminopimelate-D-alanyl-D-alanine ligase activity molecular_function

KEGG:

id description
K10577 UBE2I, UBC9; ubiquitin-conjugating enzyme E2 I

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000034_00599073_00603301.mRNA True 793 mRNA 0.46 7 599073 603301

Neighbor

gene id symbol gene type direction distance location
CI01000034_00571856_00577732 NA coding downstream 21341 571856 ~ 577775 (-)
CI01000034_00558341_00561924 C1QTNF6A, C1QTNF6 coding downstream 37078 558243 ~ 561995 (-)
CI01000034_00368808_00390623 NA coding downstream 207766 368486 ~ 391307 (-)
CI01000034_00361018_00362033 MCHR1B coding downstream 237040 360914 ~ 362033 (-)
CI01000034_00101894_00115404 NA coding downstream 483669 101052 ~ 115404 (-)
CI01000034_00604811_00614185 MPST coding upstream 1465 604766 ~ 614674 (-)
CI01000034_00627328_00635193 NA coding upstream 23718 627019 ~ 635193 (-)
CI01000034_00648618_00659733 ST13 coding upstream 44585 647886 ~ 659733 (-)
CI01000034_00728121_00732221 NA coding upstream 124137 727438 ~ 732221 (-)
CI01000034_00881526_00896469 MKL1 coding upstream 277901 881202 ~ 896469 (-)
G171382 NA non-coding downstream 45394 553304 ~ 553679 (-)
G171356 NA non-coding downstream 130365 465412 ~ 468708 (-)
G171309 NA non-coding downstream 156817 441287 ~ 442256 (-)
G171341 NA non-coding downstream 186036 412672 ~ 413037 (-)
G171340 NA non-coding downstream 186646 412193 ~ 412427 (-)
G171451 NA non-coding upstream 139765 743066 ~ 743771 (-)
G171530 NA non-coding upstream 360696 963997 ~ 964217 (-)
G171531 NA non-coding upstream 362538 965839 ~ 966103 (-)
G171404 NA non-coding upstream 475061 1078362 ~ 1080996 (-)
G171549 NA non-coding upstream 519116 1122417 ~ 1122719 (-)
G171229 NA other downstream 331827 229404 ~ 267246 (-)
CI01000034_01062505_01083413 NA other upstream 468312 1062444 ~ 1083413 (-)
CI01000034_01312431_01312780 PRR15LA other upstream 708228 1311529 ~ 1312780 (-)
G171755 NA other upstream 1260817 1864118 ~ 1866373 (-)
G171835 NA other upstream 1838520 2441821 ~ 2446293 (-)
CI01000034_02510595_02511512 NA other upstream 1906512 2510061 ~ 2511521 (-)

Expression


Co-expression Network