CI01000034_01150993_01154752 (PRVA, PVALB6)


Basic Information

Item Value
gene id CI01000034_01150993_01154752
gene name PRVA, PVALB6
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 1150929 ~ 1154752 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000034_01150993_01154752.mRNA
ATCAATGGAACGAGGAGCCAGCTAAAAGCAAAAAATACAGTCTGTACTTTCACTGCACATTACCCATACTGCCAGTTGTAGAAATGGCGATGAACAGCATCCTCAACCCTGATGACATTAAAAAAGCACTGGATGCATTTAAAGCTGTCGACTCATTCGACCACAAGAGGTTTTTTGAGATGGTCGGACTGAAGGCGAAGTCGGCTGACGATGTGAAAAAGGCTTTCCATGTCCTGGATGCTGACAATAGCGGATTTATAGAAGAAGAGGAACTTAAGTTTGTTCTGAAGGGTTTTGCTACAGATGGGAGAGACCTGACCGATAAGGAGACCAAAGCATTCCTGCAGGCTGCGGACAAAGATGGAGATGGAAAGATTGGAGCAGAAGAGTTTGCTGCTCTGGTTCGTGAATAAGTGACACGGACTCTTGGCCTGTTCATACCTCATGACCCCTTGACCTCGACCTCAGCCTAATACA

Function

symbol description
pvalb6 Predicted to enable calcium ion binding activity. Predicted to be active in cytoplasm and nucleus. Is expressed in nervous system and otic vesicle. Orthologous to human PVALB (parvalbumin).

GO:

id name namespace
GO:0005575 cellular_component cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000034_01150993_01154752.mRNA True 477 mRNA 0.46 5 1150929 1154752

Neighbor

gene id symbol gene type direction distance location
CI01000034_01130811_01134095 NA coding downstream 16834 1129525 ~ 1134095 (-)
CI01000034_01109855_01118819 NA coding downstream 29345 1109839 ~ 1121584 (-)
CI01000034_01102550_01104926 DNAL4B, DNAL4A, DNAL4, RGD1559781 coding downstream 46003 1102299 ~ 1104926 (-)
CI01000034_01062505_01083413 NA coding downstream 67516 1062444 ~ 1083413 (-)
CI01000034_01021753_01050726 NA coding downstream 97574 1020122 ~ 1053355 (-)
CI01000034_01234426_01238796 NA coding upstream 79626 1234378 ~ 1238796 (-)
CI01000034_01286141_01289408 NA coding upstream 130322 1285074 ~ 1289408 (-)
CI01000034_01294226_01301994 ADSL coding upstream 139424 1294176 ~ 1301994 (-)
CI01000034_01308438_01309828 ATF4B coding upstream 153567 1308319 ~ 1310879 (-)
CI01000034_01312431_01312780 PRR15LA coding upstream 156792 1311529 ~ 1312780 (-)
G171405 NA non-coding downstream 23286 1126485 ~ 1127643 (-)
G171549 NA non-coding downstream 28210 1122417 ~ 1122719 (-)
G171404 NA non-coding downstream 69933 1078362 ~ 1080996 (-)
G171531 NA non-coding downstream 184826 965839 ~ 966103 (-)
G171530 NA non-coding downstream 186712 963997 ~ 964217 (-)
G171572 NA non-coding upstream 43226 1197978 ~ 1198270 (-)
G171582 NA non-coding upstream 93391 1248143 ~ 1248353 (-)
G171631 NA non-coding upstream 245572 1400324 ~ 1401912 (-)
G171704 NA non-coding upstream 555926 1710678 ~ 1710957 (-)
G171712 NA non-coding upstream 585892 1740644 ~ 1741140 (-)
CI01000034_00571856_00577732 NA other downstream 566646 571856 ~ 577775 (-)
G171229 NA other downstream 883683 229404 ~ 267246 (-)
G171755 NA other upstream 709366 1864118 ~ 1866373 (-)
G171835 NA other upstream 1287069 2441821 ~ 2446293 (-)
CI01000034_02510595_02511512 NA other upstream 1355061 2510061 ~ 2511521 (-)
G172016 NA other upstream 2080211 3234963 ~ 3236615 (-)

Expression


Co-expression Network