G169308


Basic Information

Item Value
gene id G169308
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 965853 ~ 966104 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU192337
GCCCAATTAGCCATTTTCTCTCCCCGGTGTCATGTGACTCGTTAGTGTTACAAGGTCTCAGGTGTGAATGGGGAGCAGGTGTGTTAAATTTGGTGTTATCACTCTCACTCTCTCATACTGGTCACTGGAAGTTCAACATGGCACCTCATGGCAAAGAACTCTCTGAGGATCTGAAAAAAAGAATTGTTGCTCTACATAAAGATGGCGTAGGCTATAAGAAGATTGCCAAGACCCTGAAACTGAGCTGCAGCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU192337 True 252 lncRNA 0.45 1 965853 966104

Neighbor

gene id symbol gene type direction distance location
CI01000034_00951238_00955839 NA coding upstream 9766 950467 ~ 956087 (+)
CI01000034_00943362_00945523 NA coding upstream 20222 943362 ~ 945631 (+)
CI01000034_00860887_00862727 NA coding upstream 102952 860887 ~ 862901 (+)
CI01000034_00821815_00825192 NA coding upstream 140648 820595 ~ 825205 (+)
CI01000034_00785411_00801907 NA coding upstream 163794 784545 ~ 803844 (+)
CI01000034_01124686_01125224 NA coding downstream 158582 1124686 ~ 1126197 (+)
CI01000034_01139725_01146104 BAIAP2L2A coding downstream 173621 1139725 ~ 1146324 (+)
CI01000034_01210160_01223724 NA coding downstream 244056 1210160 ~ 1223869 (+)
CI01000034_01305634_01306636 NA coding downstream 339530 1305634 ~ 1306844 (+)
CI01000034_01383935_01395565 NA coding downstream 417487 1383591 ~ 1396448 (+)
G169275 NA non-coding upstream 53566 912001 ~ 912287 (+)
G169262 NA non-coding upstream 54966 893619 ~ 910887 (+)
G169260 NA non-coding upstream 88800 876810 ~ 877053 (+)
G169259 NA non-coding upstream 90442 874777 ~ 875411 (+)
G169210 NA non-coding upstream 93453 872002 ~ 872400 (+)
G169312 NA non-coding downstream 13407 979511 ~ 982209 (+)
G169302 NA non-coding downstream 27056 993160 ~ 1021824 (+)
G169357 NA non-coding downstream 87439 1053543 ~ 1119019 (+)
G169300 NA non-coding downstream 96151 1062255 ~ 1062988 (+)
G169366 NA non-coding downstream 106056 1072160 ~ 1073203 (+)
CI01000034_00643011_00645310 RBX1 other upstream 319443 642901 ~ 645310 (+)
G169309 NA other downstream 3157 969261 ~ 969921 (+)
G169394 NA other downstream 184193 1150297 ~ 1193560 (+)
G169340 NA other downstream 284115 1250219 ~ 1310878 (+)
CI01000034_01729413_01730790 EVE1 other downstream 760406 1729413 ~ 1731179 (+)

Expression


Co-expression Network