G169417


Basic Information

Item Value
gene id G169417
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 1232887 ~ 1233089 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU192478
GGAAAATTGGTATTCAATTTGGTATGCTGCACTGAATCAACAGACACCAGTTTAATGATTTTTGACCAAATCAGAAGTTATAAGCAAAAAAAGCTATTTTTCATATCTCCTGAACAGTAGGTGGCACTATGCCGAAATGCTGCAAGTAGCCTCAGGTCATGGTTCTAATGACATGTACCAAGTTTCGTCTTAATACACTAAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU192478 True 203 lncRNA 0.37 1 1232887 1233089

Neighbor

gene id symbol gene type direction distance location
CI01000034_01210160_01223724 NA coding upstream 9018 1210160 ~ 1223869 (+)
CI01000034_01139725_01146104 BAIAP2L2A coding upstream 86563 1139725 ~ 1146324 (+)
CI01000034_01124686_01125224 NA coding upstream 106690 1124686 ~ 1126197 (+)
CI01000034_00951238_00955839 NA coding upstream 276800 950467 ~ 956087 (+)
CI01000034_00943362_00945523 NA coding upstream 287256 943362 ~ 945631 (+)
CI01000034_01305634_01306636 NA coding downstream 72545 1305634 ~ 1306844 (+)
CI01000034_01383935_01395565 NA coding downstream 150502 1383591 ~ 1396448 (+)
CI01000034_01632580_01633233 NA coding downstream 398913 1632002 ~ 1633525 (+)
CI01000034_01637348_01637904 NA coding downstream 403522 1636611 ~ 1638009 (+)
CI01000034_01657515_01658817 NA coding downstream 424121 1657210 ~ 1659106 (+)
G169391 NA non-coding upstream 100419 1127749 ~ 1132468 (+)
G169392 NA non-coding upstream 105243 1126456 ~ 1127644 (+)
G169352 NA non-coding upstream 142614 1087419 ~ 1090273 (+)
G169351 NA non-coding upstream 149625 1082703 ~ 1083262 (+)
G169422 NA non-coding downstream 15058 1248147 ~ 1248372 (+)
G169435 NA non-coding downstream 61080 1294169 ~ 1302067 (+)
G169434 NA non-coding downstream 62502 1295591 ~ 1296004 (+)
G169456 NA non-coding downstream 120069 1353158 ~ 1353446 (+)
G169458 NA non-coding downstream 123904 1356993 ~ 1357240 (+)
G169394 NA other upstream 39327 1150297 ~ 1193560 (+)
G169357 NA other upstream 113868 1053543 ~ 1119019 (+)
G169309 NA other upstream 262966 969261 ~ 969921 (+)
CI01000034_00643011_00645310 RBX1 other upstream 586477 642901 ~ 645310 (+)
G169340 NA other downstream 17130 1250219 ~ 1310878 (+)
CI01000034_01729413_01730790 EVE1 other downstream 493421 1729413 ~ 1731179 (+)
G169806 NA other downstream 1084884 2317973 ~ 2337690 (+)
CI01000034_03432846_03437608 NDUFA4, NDUFA4L other downstream 2201047 3432846 ~ 3438839 (+)
CI01000034_04125435_04125780 RPRML other downstream 2892011 4125100 ~ 4126825 (+)

Expression


Co-expression Network