G169946


Basic Information

Item Value
gene id G169946
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 2588940 ~ 2589235 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU193079
GTGGATATGCATTGCTAAGGACTTCATTTAGACAACTTTAAAGGCGATTTTCTCAATATTTAGATTTTTTGTGCACCCTCAGATTCCAGATTTTCAAATAGTTGTATCTCAGCCAAATATTGTCCTATCCTAAGAAACATCAATGGAAAGCTTATTTATTCAGCTTTCAGATGATGTATAAATATCAATTTAAAAAAATTGACCTTGTGGTCCAGGGTCACATATAAAAGATTAGACCCATATTGAAAGAACAAAATAGTGAATGGTGAATCTCACAAATCTGTCAAAAAACATCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU193079 True 296 lncRNA 0.32 1 2588940 2589235

Neighbor

gene id symbol gene type direction distance location
CI01000034_02563086_02564052 NA coding upstream 24768 2562938 ~ 2564172 (+)
CI01000034_02550332_02552258 NA coding upstream 36101 2550332 ~ 2552839 (+)
CI01000034_02421189_02423360 NA coding upstream 165413 2421026 ~ 2423527 (+)
CI01000034_02275470_02281951 CYB561 coding upstream 306336 2274601 ~ 2282604 (+)
CI01000034_02256162_02260170 NA coding upstream 328476 2255765 ~ 2260464 (+)
CI01000034_02662209_02664649 MYL4 coding downstream 72974 2662209 ~ 2665540 (+)
CI01000034_02688043_02705526 MAPTB coding downstream 98710 2687945 ~ 2705564 (+)
CI01000034_02770255_02774341 NA coding downstream 180864 2770099 ~ 2774567 (+)
CI01000034_02957414_02963572 NA coding downstream 367860 2957095 ~ 2964031 (+)
CI01000034_03145811_03149071 NA coding downstream 556390 3145625 ~ 3149071 (+)
G169927 NA non-coding upstream 911 2548634 ~ 2588029 (+)
G169921 NA non-coding upstream 78246 2509779 ~ 2510694 (+)
G169922 NA non-coding upstream 79909 2506645 ~ 2509031 (+)
G169906 NA non-coding upstream 111474 2476276 ~ 2477466 (+)
G169760 NA non-coding upstream 284842 2235008 ~ 2304098 (+)
G169947 NA non-coding downstream 1126 2590361 ~ 2590615 (+)
G169974 NA non-coding downstream 65961 2655196 ~ 2658101 (+)
G169996 NA non-coding downstream 77926 2667161 ~ 2667374 (+)
G169983 NA non-coding downstream 121063 2710298 ~ 2718282 (+)
G169806 NA other upstream 251250 2317973 ~ 2337690 (+)
CI01000034_01729413_01730790 EVE1 other upstream 857763 1729413 ~ 1731179 (+)
G169340 NA other upstream 1278062 1250219 ~ 1310878 (+)
G169394 NA other upstream 1395380 1150297 ~ 1193560 (+)
G169357 NA other upstream 1469921 1053543 ~ 1119019 (+)
CI01000034_03432846_03437608 NDUFA4, NDUFA4L other downstream 844901 3432846 ~ 3438839 (+)
CI01000034_04125435_04125780 RPRML other downstream 1535865 4125100 ~ 4126825 (+)
CI01000034_04192675_04200041 NA other downstream 1605403 4192311 ~ 4200636 (+)

Expression


Co-expression Network