G172048


Basic Information

Item Value
gene id G172048
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 3144604 ~ 3144832 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU195465
CAGCTAACCTTTCTGTATATGACGAGGCTTTTGACAGAAGGACACTTGGAGGACTCAATGTATGGAGAGAGGGAGCAACCGGATCATTTTGCATAGACTTCCTTTGTGAAAAAGAGATGAAAATGTTCAGTCTGTATGATGCATGTGTTTGAAATGTGGAAATCAATGTATCATGAACTAATATGCACTGCAGTCACAACAACCTGGAGCTGAACATGCTCAAAGCAGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU195465 True 229 lncRNA 0.41 1 3144604 3144832

Neighbor

gene id symbol gene type direction distance location
CI01000034_02875948_02953386 CRHR2, CRHR1 coding downstream 190084 2875658 ~ 2954520 (-)
CI01000034_02778206_02786310 CDC27 coding downstream 358294 2777700 ~ 2786310 (-)
CI01000034_02712912_02755978 KANSL1B coding downstream 388626 2712687 ~ 2755978 (-)
CI01000034_02673701_02680445 NA coding downstream 463851 2673521 ~ 2680753 (-)
CI01000034_02596578_02625089 SCN4AB coding downstream 519197 2596169 ~ 2625407 (-)
CI01000034_03247806_03248810 NA coding upstream 102962 3247794 ~ 3248947 (-)
CI01000034_03250695_03253982 NA coding upstream 105570 3250402 ~ 3254202 (-)
CI01000034_03255619_03266388 NA coding upstream 110436 3255268 ~ 3267690 (-)
CI01000034_03285980_03289258 NA coding upstream 140958 3285790 ~ 3289258 (-)
CI01000034_03577874_03611044 NA coding upstream 432622 3577454 ~ 3611099 (-)
G171960 NA non-coding downstream 298983 2845229 ~ 2845621 (-)
G171947 NA non-coding downstream 345415 2798911 ~ 2799189 (-)
G171946 NA non-coding downstream 349160 2795158 ~ 2795444 (-)
G171927 NA non-coding downstream 368220 2775940 ~ 2776384 (-)
G171920 NA non-coding downstream 370364 2766090 ~ 2774240 (-)
G172022 NA non-coding upstream 7049 3151881 ~ 3171535 (-)
G172031 NA non-coding upstream 45080 3189912 ~ 3190509 (-)
G172020 NA non-coding upstream 65874 3210706 ~ 3214094 (-)
G172025 NA non-coding upstream 82527 3227359 ~ 3231997 (-)
G172019 NA non-coding upstream 88687 3233519 ~ 3233712 (-)
CI01000034_02510595_02511512 NA other downstream 633083 2510061 ~ 2511521 (-)
G171835 NA other downstream 698311 2441821 ~ 2446293 (-)
G171755 NA other downstream 1278231 1864118 ~ 1866373 (-)
CI01000034_01312431_01312780 PRR15LA other downstream 1826350 1311529 ~ 1312780 (-)
CI01000034_01062505_01083413 NA other downstream 2067382 1062444 ~ 1083413 (-)
G172016 NA other upstream 90131 3234963 ~ 3236615 (-)
G172151 NA other upstream 246681 3391144 ~ 3451802 (-)
CI01000034_04165535_04172272 KCTD13 other upstream 1021667 4165373 ~ 4172272 (-)
CI01000034_04216451_04218876 NA other upstream 1071380 4216212 ~ 4221881 (-)
G172593 NA other upstream 1848128 4992960 ~ 4994943 (-)

Expression


Co-expression Network