G172031


Basic Information

Item Value
gene id G172031
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 3189912 ~ 3190509 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU195448
CATGATTCCAGAGAAGCCCATAAACACTAACTGGTCTTGCTCTAGCAGTTCTGACAGGAAGTCCAGTTAATGCACGTGAATTTCAGAATGAAACTGAATACTCGGTTTCTAATAATATTCTGCCCAGGCTTCCCCTGTCACAATGTAGAAAAAAGTTCANNNNTACAGTAGTACAGCAAGTACTCACGCGGGATGCGGCTGGCATGCCAGGGTGCAGAGTTTGTGACAAATCCATGCTTTGATGCTGTGACGATGACCCACGTTCCTGGCCGGTACAGGAACGTAAGTGTGACAATCCCATCTCCCCCAGCAAGGCTGGATGCTAAGATGGTCTGGTTTCCACACACCTGAACTCTGGATTCCTTTAGGGGTGACAGGTCGCTGTTGTCGAAAACCTGGACTTTAATCAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU195448 True 411 lncRNA 0.47 2 3189912 3190509

Neighbor

gene id symbol gene type direction distance location
CI01000034_02875948_02953386 CRHR2, CRHR1 coding downstream 235392 2875658 ~ 2954520 (-)
CI01000034_02778206_02786310 CDC27 coding downstream 403602 2777700 ~ 2786310 (-)
CI01000034_02712912_02755978 KANSL1B coding downstream 433934 2712687 ~ 2755978 (-)
CI01000034_02673701_02680445 NA coding downstream 509159 2673521 ~ 2680753 (-)
CI01000034_02596578_02625089 SCN4AB coding downstream 564505 2596169 ~ 2625407 (-)
CI01000034_03247806_03248810 NA coding upstream 57285 3247794 ~ 3248947 (-)
CI01000034_03250695_03253982 NA coding upstream 59893 3250402 ~ 3254202 (-)
CI01000034_03255619_03266388 NA coding upstream 64759 3255268 ~ 3267690 (-)
CI01000034_03285980_03289258 NA coding upstream 95281 3285790 ~ 3289258 (-)
CI01000034_03577874_03611044 NA coding upstream 386945 3577454 ~ 3611099 (-)
G172022 NA non-coding downstream 18377 3151881 ~ 3171535 (-)
G172048 NA non-coding downstream 45080 3144604 ~ 3144832 (-)
G171960 NA non-coding downstream 344291 2845229 ~ 2845621 (-)
G171947 NA non-coding downstream 390723 2798911 ~ 2799189 (-)
G171946 NA non-coding downstream 394468 2795158 ~ 2795444 (-)
G172020 NA non-coding upstream 20197 3210706 ~ 3214094 (-)
G172025 NA non-coding upstream 36850 3227359 ~ 3231997 (-)
G172019 NA non-coding upstream 43010 3233519 ~ 3233712 (-)
G172016 NA non-coding upstream 44454 3234963 ~ 3236615 (-)
G172088 NA non-coding upstream 71324 3261833 ~ 3262036 (-)
CI01000034_02510595_02511512 NA other downstream 678391 2510061 ~ 2511521 (-)
G171835 NA other downstream 743619 2441821 ~ 2446293 (-)
G171755 NA other downstream 1323539 1864118 ~ 1866373 (-)
CI01000034_01312431_01312780 PRR15LA other downstream 1871658 1311529 ~ 1312780 (-)
CI01000034_01062505_01083413 NA other downstream 2112690 1062444 ~ 1083413 (-)
G172151 NA other upstream 201004 3391144 ~ 3451802 (-)
CI01000034_04165535_04172272 KCTD13 other upstream 975990 4165373 ~ 4172272 (-)
CI01000034_04216451_04218876 NA other upstream 1025703 4216212 ~ 4221881 (-)
G172593 NA other upstream 1802451 4992960 ~ 4994943 (-)

Expression


Co-expression Network