G172170


Basic Information

Item Value
gene id G172170
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 3486714 ~ 3486924 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU195612
GGGTGTGGAACGACATGAGGGTGAATAATTAATGACAGAAATTTCATTTTTGGGTGAACTAACCCTTTAACTGTGATTTTTTTGATGAAAGTCTGAATTTCTCTCAATTAACAGATTTTCTCTAGTTACAGTTGGCAGTGTTTATGAGGGGAAAGATTTATTGCTATGCTTGATTGCATGCGATAATTATCACAAAAGAATAAACAAGCGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU195612 True 211 lncRNA 0.34 1 3486714 3486924

Neighbor

gene id symbol gene type direction distance location
CI01000034_03285980_03289258 NA coding downstream 197456 3285790 ~ 3289258 (-)
CI01000034_03255619_03266388 NA coding downstream 219024 3255268 ~ 3267690 (-)
CI01000034_03250695_03253982 NA coding downstream 232512 3250402 ~ 3254202 (-)
CI01000034_03247806_03248810 NA coding downstream 237767 3247794 ~ 3248947 (-)
CI01000034_02875948_02953386 CRHR2, CRHR1 coding downstream 532194 2875658 ~ 2954520 (-)
CI01000034_03577874_03611044 NA coding upstream 90530 3577454 ~ 3611099 (-)
CI01000034_03659420_03661699 NXPH3 coding upstream 172366 3659290 ~ 3661699 (-)
CI01000034_03803160_03827982 NGFRA coding upstream 315908 3802832 ~ 3827982 (-)
CI01000034_03911480_03913846 TMUB2 coding upstream 424151 3911075 ~ 3913846 (-)
CI01000034_03915853_03921269 ASB16 coding upstream 428827 3915751 ~ 3921269 (-)
G172151 NA non-coding downstream 34912 3391144 ~ 3451802 (-)
G172149 NA non-coding downstream 97940 3388487 ~ 3388774 (-)
G172148 NA non-coding downstream 98476 3388002 ~ 3388238 (-)
G172147 NA non-coding downstream 98845 3387632 ~ 3387869 (-)
G172021 NA non-coding downstream 156220 3328810 ~ 3330494 (-)
G172222 NA non-coding upstream 84289 3571213 ~ 3571431 (-)
G172225 NA non-coding upstream 86991 3573915 ~ 3574185 (-)
G172226 NA non-coding upstream 87433 3574357 ~ 3574705 (-)
G172227 NA non-coding upstream 88287 3575211 ~ 3575418 (-)
G172228 NA non-coding upstream 88553 3575477 ~ 3575688 (-)
G172016 NA other downstream 250099 3234963 ~ 3236615 (-)
CI01000034_02510595_02511512 NA other downstream 975193 2510061 ~ 2511521 (-)
G171835 NA other downstream 1040421 2441821 ~ 2446293 (-)
G171755 NA other downstream 1620341 1864118 ~ 1866373 (-)
CI01000034_04165535_04172272 KCTD13 other upstream 679575 4165373 ~ 4172272 (-)
CI01000034_04216451_04218876 NA other upstream 729288 4216212 ~ 4221881 (-)
G172593 NA other upstream 1506036 4992960 ~ 4994943 (-)
G172800 NA other upstream 2302108 5789032 ~ 5789738 (-)
CI01000034_05795972_05811363 NA other upstream 2310646 5795835 ~ 5811781 (-)

Expression


Co-expression Network