G170305



Basic Information


Item Value
gene id G170305
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 3576427 ~ 3576638 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU193485
CTACTGTAAATTCCGATTTTTGCGCGCGCTGTGTTATCTGAGCTCTCGTCTTCTCCGTGGTCTCGTCCGACAGATTCAGCGGTAAGTGTTGAAATGTCAAATTTGTCAATTAAATGACTGTTTGTTTGTTTTTTTTATATGTTAGTGCGTGTAATTTAAAAGTATTAACCAAATACTGTTAGTTGCAGATTCTGTTGACATGTTGTTAGCGG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU193485 True 212 lncRNA 0.38 1 3576427 3576638

Neighbor


gene id symbol gene type direction distance location
CI01000034_03556390_03566045 NA coding upstream 9902 3554625 ~ 3566525 (+)
CI01000034_03533995_03552021 SPOP coding upstream 24322 3533995 ~ 3552105 (+)
CI01000034_03432846_03437608 NDUFA4, NDUFA4L coding upstream 138594 3432846 ~ 3438839 (+)
CI01000034_03422028_03431218 SLC35B1, S35B1 coding upstream 144831 3421289 ~ 3431596 (+)
CI01000034_03407574_03419313 FAM117A, FAM117AA coding upstream 157036 3405952 ~ 3419391 (+)
CI01000034_03656686_03659087 NA coding downstream 80048 3656686 ~ 3659172 (+)
CI01000034_03670122_03684523 NA coding downstream 93305 3669943 ~ 3685216 (+)
CI01000034_03855726_03858565 NA coding downstream 278913 3855551 ~ 3859311 (+)
CI01000034_03869116_03883535 SLC4A1A coding downstream 292478 3869116 ~ 3883690 (+)
CI01000034_03887718_03890074 NA coding downstream 310527 3887165 ~ 3890409 (+)
CI01000034_03273191_03285382 NA non-coding upstream 279204 3272420 ~ 3294805 (+)
G170280 NA non-coding upstream 293255 3281406 ~ 3283172 (+)
G170276 NA non-coding upstream 316391 3259782 ~ 3260036 (+)
G170274 NA non-coding upstream 318358 3257790 ~ 3258069 (+)
G170328 NA non-coding downstream 21040 3597678 ~ 3597877 (+)
G170330 NA non-coding downstream 22064 3598702 ~ 3598939 (+)
G170332 NA non-coding downstream 23366 3600004 ~ 3600216 (+)
G170336 NA non-coding downstream 26376 3603014 ~ 3603228 (+)
G170339 NA non-coding downstream 30063 3606701 ~ 3606923 (+)
G169806 NA other upstream 1238737 2317973 ~ 2337690 (+)
CI01000034_01729413_01730790 EVE1 other upstream 1845250 1729413 ~ 1731179 (+)
G169340 NA other upstream 2265549 1250219 ~ 1310878 (+)
G169394 NA other upstream 2382867 1150297 ~ 1193560 (+)
CI01000034_04125435_04125780 RPRML other downstream 548462 4125100 ~ 4126825 (+)
CI01000034_04192675_04200041 NA other downstream 618000 4192311 ~ 4200636 (+)

Expression



Co-expression Network