G172235


Basic Information

Item Value
gene id G172235
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 3588156 ~ 3588357 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU195680
CTTCCTTTTCTCCCATTCTCCCTCAAATCGGAAATCTACTGTTCAAAACATCAGCTTCTTTTTTAACACAACATATTCGTCCACAGCTCATCTTTAAACTTTCTTTCCACCCCCTTTTTCATCTTTCCTATTCTTTTCAATCTCTCAATACCTCTTTTTTTAATTGCTCGCAGTTCTGAAGCCCCTAAAAAGTCATCTGCCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU195680 True 202 lncRNA 0.38 1 3588156 3588357

Neighbor

gene id symbol gene type direction distance location
CI01000034_03285980_03289258 NA coding downstream 298898 3285790 ~ 3289258 (-)
CI01000034_03255619_03266388 NA coding downstream 320466 3255268 ~ 3267690 (-)
CI01000034_03250695_03253982 NA coding downstream 333954 3250402 ~ 3254202 (-)
CI01000034_03247806_03248810 NA coding downstream 339209 3247794 ~ 3248947 (-)
CI01000034_02875948_02953386 CRHR2, CRHR1 coding downstream 633636 2875658 ~ 2954520 (-)
CI01000034_03659420_03661699 NXPH3 coding upstream 70933 3659290 ~ 3661699 (-)
CI01000034_03803160_03827982 NGFRA coding upstream 214475 3802832 ~ 3827982 (-)
CI01000034_03911480_03913846 TMUB2 coding upstream 322718 3911075 ~ 3913846 (-)
CI01000034_03915853_03921269 ASB16 coding upstream 327394 3915751 ~ 3921269 (-)
CI01000034_03956763_03960891 NA coding upstream 368406 3956763 ~ 3960891 (-)
G172234 NA non-coding downstream 1580 3586347 ~ 3586576 (-)
G172228 NA non-coding downstream 12468 3575477 ~ 3575688 (-)
G172227 NA non-coding downstream 12738 3575211 ~ 3575418 (-)
G172226 NA non-coding downstream 13451 3574357 ~ 3574705 (-)
G172225 NA non-coding downstream 13971 3573915 ~ 3574185 (-)
G172240 NA non-coding upstream 9235 3597592 ~ 3597878 (-)
G172346 NA non-coding upstream 262224 3850581 ~ 3850902 (-)
G172314 NA non-coding upstream 282371 3870728 ~ 3874382 (-)
G172312 NA non-coding upstream 340548 3928905 ~ 3931285 (-)
G172303 NA non-coding upstream 343271 3931628 ~ 3932617 (-)
G172151 NA other downstream 190343 3391144 ~ 3451802 (-)
G172016 NA other downstream 351541 3234963 ~ 3236615 (-)
CI01000034_02510595_02511512 NA other downstream 1076635 2510061 ~ 2511521 (-)
G171835 NA other downstream 1141863 2441821 ~ 2446293 (-)
G171755 NA other downstream 1721783 1864118 ~ 1866373 (-)
CI01000034_04165535_04172272 KCTD13 other upstream 578142 4165373 ~ 4172272 (-)
CI01000034_04216451_04218876 NA other upstream 627855 4216212 ~ 4221881 (-)
G172593 NA other upstream 1404603 4992960 ~ 4994943 (-)
G172800 NA other upstream 2200675 5789032 ~ 5789738 (-)
CI01000034_05795972_05811363 NA other upstream 2209213 5795835 ~ 5811781 (-)

Expression


Co-expression Network